View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5612_low_5 (Length: 241)
Name: NF5612_low_5
Description: NF5612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5612_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 5328731 - 5328521
Alignment:
| Q |
13 |
ataatacttgataattcttttgaggatttgttgtttttattagaagaacaagaaaaataaacatgagatttcaatcactctagtagtcaattcctagtta |
112 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
5328731 |
ataacacttgataattattttgaggatttgttgtttttattagaagaacaagaaaaataaacatgtgatttcaatcactcttgtagtcaattcctagtta |
5328632 |
T |
 |
| Q |
113 |
cactaacctcattctctttactatatgagtatacaatgttttattttgagaataacactagcctaattctcattactatctgtctatacacattgttgtg |
212 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
5328631 |
caccaacctcattctctttactatatgtgtatacaatgttttattttgagaataacactagcctaattctcattactatccgtctatatacattgttgtg |
5328532 |
T |
 |
| Q |
213 |
cacacaaatag |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
5328531 |
cacacaaatag |
5328521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University