View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5612_low_8 (Length: 226)
Name: NF5612_low_8
Description: NF5612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5612_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 11871733 - 11871562
Alignment:
| Q |
18 |
gtaaatgagcgaatcattcaagaaaacccatgttcgatttttggttggaacaatttttgaccagactatcattatttcacaatccaactttgaattacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||| ||||||| || |
|
|
| T |
11871733 |
gtaaatgagcgaatcattcaagaaaacccatgttcgatttttggatggaacaatttttgaccagactatcattacttcacaacccaactctgaattatta |
11871634 |
T |
 |
| Q |
118 |
gagcctattttcatctgggaatcgaagagttaacacc-aagtggcaatattttcgtgcttctgagaacacag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
11871633 |
gagcctattttcatctgggaatcgaagagttaacgccaaagtggcaatattttcgtgcttctgagaacacag |
11871562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University