View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5613_low_6 (Length: 219)
Name: NF5613_low_6
Description: NF5613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5613_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 40130643 - 40130452
Alignment:
| Q |
12 |
cgaagaatattgttttgtatacaatcagggaccttagtcgtaacatcatcactggttctatacctcaacaatgggctaaaatgaacttggttgatttgta |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40130643 |
cgaacaatattgttttgtatacaatcagggaccttagtcgtaacatcatcactggttctatccctcaacaatgggctaaaatgaacttggttgatttgta |
40130544 |
T |
 |
| Q |
112 |
agaactttctgctatgcacattttgatcattgcctcttaaatttcttctttttcaagtaagcaaactgaaagtgacactaaagtttgttgtg |
203 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40130543 |
agaactttctgctatgcacattttggtcattgcctcttaaatttcttctttttcaagtaagcaaattgaaagtgacactaaagtttgttgtg |
40130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University