View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5614_high_11 (Length: 210)
Name: NF5614_high_11
Description: NF5614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5614_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 46001930 - 46001828
Alignment:
| Q |
1 |
aaaatggtaaagtgtgagaaggaactttctcaaaacatgcaggttaatggtttctctcttgtaattttaatttaattcaaatgacaaattaattatatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46001930 |
aaaatggtaaagtgtgagaaggaactttctcaaaacatg---gttaatggtttctctcttgtaattttaatttaattcaaatgacaaattaattatatcc |
46001834 |
T |
|
| Q |
101 |
tctaag |
106 |
Q |
| |
|
|||||| |
|
|
| T |
46001833 |
tctaag |
46001828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 102 - 193
Target Start/End: Complemental strand, 46001451 - 46001360
Alignment:
| Q |
102 |
ctaagttgggtagcaaatgagtttataaacatcaacaaacatacacatgtaacacatactaagggatctatataatattgcagcaactaaat |
193 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46001451 |
ctaagttggatagcaaatgagtttataaacatcaacaaacatacacatgtaacacatactaagggatctatataatattgcagcaactaaat |
46001360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University