View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5614_high_7 (Length: 258)
Name: NF5614_high_7
Description: NF5614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5614_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 52429069 - 52429294
Alignment:
| Q |
1 |
aacttctctgctaactcagtattacttctccnnnnnnncaaactagtactttctgcttcttgcacctccttttccataacagaaccactggaattttgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52429069 |
aacttctctgctaactcagtattacttctccttttcttcaaactagtactttctgcttcttgcacctccttttccataacagaaccactggaattttgct |
52429168 |
T |
 |
| Q |
101 |
gcaaaggcttctcattttctttgtcttcagaaacatcagattcagaatgaaactgtgattgttgtttagggctttctgccacgtgccaaggagataaacg |
200 |
Q |
| |
|
| || |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52429169 |
gtaacggcttctcattttcttcgtcttcagaaacatcagattcagaatgaaactgtgattgttgtttagggctttctgccacgtgccaaggagataaacg |
52429268 |
T |
 |
| Q |
201 |
ctttggaaactcaaaattcacaggtt |
226 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
52429269 |
ctttggaaactcaaaattcagaggtt |
52429294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University