View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5614_high_9 (Length: 251)
Name: NF5614_high_9
Description: NF5614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5614_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 48065844 - 48066087
Alignment:
| Q |
1 |
tagaaattacatgtacttgaagttagatggatatttccacttcttctatctaatttaagaccattcatgacgattgagcggtttgctttaaatcattggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48065844 |
tagaaattacatgtacttgaagttagatggatatttccacttcttctatctaatttaagaccatccatgacgattgagcggtttgctttaaatcattggc |
48065943 |
T |
|
| Q |
101 |
aggtggtagaaacaagacattaatgagtttacatttcagagtgtcaaatgatcaaaccttatatatcccccttcccaattgcatgatccataccaaaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48065944 |
aggtggtagaaacaagacattaatgagtttacatttcagagtgtcaaatgatcaaaccttatatatcccccttcccaattgcatgatccataccaaaatg |
48066043 |
T |
|
| Q |
201 |
agattcacattattatacaaataataacactcttgtctctgctc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48066044 |
agattcacattattatacaaataataacactcttgtcactgctc |
48066087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 48083250 - 48083316
Alignment:
| Q |
1 |
tagaaattacatgtacttgaagttagatggatatttccacttc--ttc--tatctaatttaagacca |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||| ||| ||||||||||||||||| |
|
|
| T |
48083250 |
tagaaattacatgtacttgaagttagatggatgttttcacttcaattctatatctaatttaagacca |
48083316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University