View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5614_low_2 (Length: 375)
Name: NF5614_low_2
Description: NF5614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5614_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 20 - 357
Target Start/End: Complemental strand, 40725265 - 40724928
Alignment:
| Q |
20 |
aaaatctcactgaaatcatctccaaagaatgggccattttctttctcatcaagattgcttatttcattctcatctttagtctctatctcttctccacctc |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40725265 |
aaaatctcactgaaatcatcaccaaagaatgggccattttctttctcatcaagattgcatatttcattctcatctttagcctctatctcttctccacctc |
40725166 |
T |
|
| Q |
120 |
tgctattgtttacaccgtcgcttccatctataccggcaacaaagacatagccttcaacaaggtcatgagtgttatcacaaacctttctaaaagacttatg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40725165 |
cgctattgtttacaccgtcgcttccatctacaccggcaacaaagacatagccttcaacaaagtcatgagtgttatcacaaacctttcaaaaagacttatg |
40725066 |
T |
|
| Q |
220 |
gtcacttttttgtgcactcttacagccggtttcttttacaacattatagcaatggtgattgcgattatatttgcgcttacattcggtgtacgaaatggtg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40725065 |
gtcacttttttgtgcactcttacagccggtttcttttacaacattatagcaatggtgattgcgattatatttgcgcttacattcggtgtacgaaatggtg |
40724966 |
T |
|
| Q |
320 |
gatcagttgccggttttatcatcataggaatcttatat |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40724965 |
gatcagttgccggttttatcatcataggaatcttatat |
40724928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University