View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5615-Insertion-6 (Length: 166)
Name: NF5615-Insertion-6
Description: NF5615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5615-Insertion-6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 7 - 164
Target Start/End: Original strand, 1712692 - 1712849
Alignment:
| Q |
7 |
aacaattccattattgtaacaacaaatatgaagaaccaagttggttatgttccacctgcttacattccattgggtcaatcagattcagaggcaatgagtg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1712692 |
aacaattccattattgtaacaacaaatatgaagaaccaagttggttatgttccacctgcttacattccattgggtcaatcagattcagaggcaatgagtc |
1712791 |
T |
|
| Q |
107 |
tctctcctctacaccatggtggtagtagcagcaatgtttcaaatcaatggtcttctgg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1712792 |
tctctcctctacaccatggtggtagtagtagcaatgtttcaaatcaatggtcttctgg |
1712849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University