View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5616-Insertion-9 (Length: 625)
Name: NF5616-Insertion-9
Description: NF5616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5616-Insertion-9 |
 |  |
|
| [»] chr5 (141 HSPs) |
 |  |
|
| [»] chr8 (87 HSPs) |
 |  |
|
| [»] scaffold0170 (3 HSPs) |
 |  |
|
| [»] chr7 (115 HSPs) |
 |  |
|
| [»] chr2 (132 HSPs) |
 |  |
|
| [»] scaffold0044 (4 HSPs) |
 |  |
|
| [»] chr4 (143 HSPs) |
 |  |
|
| [»] chr6 (97 HSPs) |
 |  |
|
| [»] chr3 (128 HSPs) |
 |  |
|
| [»] scaffold0045 (4 HSPs) |
 |  |
|
| [»] scaffold0015 (3 HSPs) |
 |  |
|
| [»] scaffold0302 (5 HSPs) |
 |  |
|
| [»] scaffold0009 (4 HSPs) |
 |  |
|
| [»] scaffold0651 (4 HSPs) |
 |  |
|
| [»] scaffold0825 (2 HSPs) |
 |  |  |
|
| [»] scaffold0185 (2 HSPs) |
 |  |
|
| [»] scaffold0079 (5 HSPs) |
 |  |
|
| [»] scaffold0036 (4 HSPs) |
 |  |
|
| [»] scaffold0275 (3 HSPs) |
 |  |
|
| [»] scaffold0229 (1 HSPs) |
 |  |  |
|
| [»] scaffold0838 (1 HSPs) |
 |  |
|
| [»] scaffold0832 (1 HSPs) |
 |  |
|
| [»] scaffold0385 (2 HSPs) |
 |  |  |
|
| [»] scaffold0421 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 8e-32; HSPs: 141)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 5214641 - 5214559
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5214641 |
gtgtcattggtccatgcactttcatcagattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
5214559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 23592856 - 23592774
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23592856 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
23592774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 13197918 - 13198000
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13197918 |
gtgtcattggtccatgcactttcatcagattttggcattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
13198000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 5907327 - 5907379
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5907327 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
5907379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 8144741 - 8144793
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8144741 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
8144793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 8343374 - 8343322
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8343374 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
8343322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 20166411 - 20166359
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20166411 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
20166359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 22619515 - 22619567
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22619515 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
22619567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 23592548 - 23592600
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23592548 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
23592600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 23910363 - 23910415
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23910363 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
23910415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 25945397 - 25945449
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25945397 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
25945449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 26408705 - 26408757
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26408705 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
26408757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 38244891 - 38244943
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38244891 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
38244943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 578 - 625
Target Start/End: Complemental strand, 38790289 - 38790242
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38790289 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
38790242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 8343114 - 8343160
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8343114 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
8343160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 18673919 - 18674001
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| | || ||| ||| |||||| |||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18673919 |
gtgtcattggtccctacacttttatcatattttggcattcgtccctgcactttgtaaaaatattggtattggttcctctgtta |
18674001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 22619775 - 22619729
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22619775 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
22619729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 571 - 625
Target Start/End: Complemental strand, 30492215 - 30492161
Alignment:
| Q |
571 |
attttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30492215 |
attttggcattggtccctacactttgtaaaaatattggtattggtccctctgtta |
30492161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 973895 - 973944
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
973895 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctg |
973944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 3578303 - 3578251
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3578303 |
tttggcattggtccctgcactttgtaaaaatattggtattggtctctctgtta |
3578251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 11062663 - 11062611
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11062663 |
tttggcattggtccctgcactttgtaaaaatattagtattggtccctctgtta |
11062611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 15442964 - 15442912
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15442964 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccttctgtta |
15442912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 16969030 - 16968978
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16969030 |
tttggcattggtccctgcactttgtaaaaatattggtattgatccctctgtta |
16968978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 17964717 - 17964769
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17964717 |
tttggcattggtccctgcactttgtataaatattggtattggtccctctgtta |
17964769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 621
Target Start/End: Original strand, 18036287 - 18036335
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18036287 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtccctct |
18036335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 18705591 - 18705643
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18705591 |
tttggcattggtccctgcactttgtaaaaatattggtattgatccctctgtta |
18705643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 557 - 617
Target Start/End: Complemental strand, 21748021 - 21747961
Alignment:
| Q |
557 |
tgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21748021 |
tgcactttcatcagattttgacattggttcctgcactttgtaaaaatattggtattggtcc |
21747961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 32792431 - 32792483
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32792431 |
tttggcattggtccctgcactttgtaaaaatattggtattggtctctctgtta |
32792483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 5214340 - 5214382
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5214340 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
5214382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 17964988 - 17964946
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17964988 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
17964946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 26408976 - 26408934
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26408976 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
26408934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 573 - 619
Target Start/End: Complemental strand, 27858653 - 27858607
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27858653 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccct |
27858607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 38790023 - 38790065
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38790023 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
38790065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 39412226 - 39412268
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39412226 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
39412268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 579 - 620
Target Start/End: Complemental strand, 26408893 - 26408852
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctc |
620 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26408893 |
attggtccctgcactttgtaaaaatattggtattggtccctc |
26408852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 617
Target Start/End: Original strand, 2268324 - 2268368
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2268324 |
tttggcattggtccctgcactttgtaaaaatattggtattggtcc |
2268368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 13198228 - 13198180
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13198228 |
tttggcattggtccctgcactttgtaaaaatattgatattggtccctct |
13198180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 15440674 - 15440714
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15440674 |
attggtccctgcactttgtaaaaatattggtattggtccct |
15440714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 18036377 - 18036417
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18036377 |
attggtccctgcactttgtaaaaatattggtattggtccct |
18036417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 18036567 - 18036515
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18036567 |
tttggcattggtccctacactttgtaaaaatattggtattggtctctctgtta |
18036515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 23592739 - 23592699
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23592739 |
attggtccctgcactttgtaaaaatattggtattggtccct |
23592699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 31912771 - 31912823
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
31912771 |
tttggcattggtccctgcactttgtaaaaatattggtattggttcttctgtta |
31912823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 38245080 - 38245040
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38245080 |
attggtccctgcactttgtaaaaatattggtattggtccct |
38245040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 39412464 - 39412412
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39412464 |
tttggcatttgtccctgtactttgtaaaaatattggtattggtccctctgtta |
39412412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 578 - 621
Target Start/End: Original strand, 27858461 - 27858504
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27858461 |
cattggtccctgcactttgtaaaaatattggtattggtctctct |
27858504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 4621009 - 4620963
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4621009 |
attggtccatgcactttgtaaaaatattggtattggtccatctgtta |
4620963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 4717152 - 4717106
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
4717152 |
attggtccctgcactttgtgaaaatattgatattggtccctctgtta |
4717106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 9177198 - 9177152
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9177198 |
attggtccctccactttgtaaaaatatttgtattggtccctctgtta |
9177152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 617
Target Start/End: Original strand, 11062422 - 11062460
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11062422 |
attggtccctgcactttgtaaaaatattggtattggtcc |
11062460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 18674187 - 18674145
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18674187 |
attggtccctgcactttgtaaaaatattggtattggtctctct |
18674145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 18705833 - 18705791
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18705833 |
attggtccctgcactttgtaaaaatattggtattgatccctct |
18705791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 25945666 - 25945624
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25945666 |
attggtccttgcactttgtaaaaatattggtattggtccctct |
25945624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 31912989 - 31912947
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31912989 |
attggtccatgcactttgtaaaaatattggtattggtccctct |
31912947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 34929610 - 34929652
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34929610 |
attggtccctgcactttgcaaaaatattggtattggtccctct |
34929652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 578 - 619
Target Start/End: Original strand, 2033893 - 2033934
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2033893 |
cattggtccttgcactttgtaaaaatattggtattggtccct |
2033934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 579 - 616
Target Start/End: Complemental strand, 2268512 - 2268475
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2268512 |
attggtccctgcactttgtaaaaatattggtattggtc |
2268475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 572 - 625
Target Start/End: Original strand, 3023461 - 3023514
Alignment:
| Q |
572 |
ttttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
3023461 |
ttttggcattggtccctgtactttgtaaaaatattggtattgatcactctgtta |
3023514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 973835 - 973887
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
973835 |
gtgtcattggtccctgcactttcatcaaattttggcattggtccctgcacttt |
973887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 2034085 - 2034033
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| |||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
2034085 |
tttgtcattgatccctgtactttgtaaaaatattggtattggtccctcagtta |
2034033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 3578156 - 3578192
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3578156 |
attggtccctgcactttgtaaaaatattggtattggt |
3578192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 4620928 - 4620888
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4620928 |
attggtccttgcactttgtaaaaatattggtattggtccct |
4620888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 4717073 - 4717033
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4717073 |
attggaccctgcactttgtaaaaatattggtattggtccct |
4717033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 5214423 - 5214463
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5214423 |
attggtccctgcactttgtaaaaatattcgtattggtccct |
5214463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 5907269 - 5907321
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
5907269 |
gtgtcattggtccctgcactttcatcaaattttggcattggtccctgcacttt |
5907321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 5907517 - 5907477
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5907517 |
attggtctctgcactttgtaaaaatattggtattggtccct |
5907477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 17964905 - 17964865
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17964905 |
attggtccctacactttgtaaaaatattggtattggtccct |
17964865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 20166218 - 20166258
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20166218 |
attggtccctgcactttgtaaaaatattgatattggtccct |
20166258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 21747740 - 21747792
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21747740 |
tttggcattggtccatgtactttgtaaaaatattggtattggtccatctgtta |
21747792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 22619706 - 22619666
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22619706 |
attggtcccagcactttgtaaaaatattggtattggtccct |
22619666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 25945585 - 25945545
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25945585 |
attgatccctgcactttgtaaaaatattggtattggtccct |
25945545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 586 - 621
Target Start/End: Original strand, 2033819 - 2033854
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2033819 |
cctgcactttgtaaaaatattggtattggtccctct |
2033854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 578 - 625
Target Start/End: Original strand, 5950526 - 5950573
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
5950526 |
cattggtccctacactttataaaaatattggtatcggtccctctgtta |
5950573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 3578074 - 3578116
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
3578074 |
attggtccctccactttgtaaaaatattggtactggtccctct |
3578116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 575 - 617
Target Start/End: Original strand, 4620752 - 4620794
Alignment:
| Q |
575 |
tgacattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
4620752 |
tgacattggtcgctgcactttgtaaaaatattgatattggtcc |
4620794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 8145011 - 8144969
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8145011 |
attgatccctgcattttgtaaaaatattggtattggtccctct |
8144969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 583 - 625
Target Start/End: Original strand, 20166140 - 20166182
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20166140 |
gtccatgcactttgtaaaaatattggtattagtccctctgtta |
20166182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 23910555 - 23910517
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23910555 |
attggtccatgcactttgtaaaaatattggtattggtcc |
23910517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 23910639 - 23910597
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
23910639 |
attggtccctgcactttataaaaatattggtatcggtccctct |
23910597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 580 - 617
Target Start/End: Complemental strand, 974084 - 974047
Alignment:
| Q |
580 |
ttggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
974084 |
ttggtccctgcactttgtaaaaataatggtattggtcc |
974047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 580 - 625
Target Start/End: Complemental strand, 13667706 - 13667661
Alignment:
| Q |
580 |
ttggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
13667706 |
ttggtccctacactttgtgaaaatattgatattggtccctctgtta |
13667661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 578 - 615
Target Start/End: Complemental strand, 18674109 - 18674072
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18674109 |
cattggtccctgcactttgtaaaaatattgatattggt |
18674072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 574 - 615
Target Start/End: Original strand, 20166244 - 20166285
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20166244 |
ttgatattggtccctgcactttgtaaaaatattgatattggt |
20166285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 574 - 615
Target Start/End: Original strand, 30492046 - 30492087
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30492046 |
ttgatattggtccctgcactttgtaaaaatattgatattggt |
30492087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 4620897 - 4620861
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4620897 |
attggtccctgcactttgtaaaaatattgatattggt |
4620861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 573 - 621
Target Start/End: Original strand, 4716886 - 4716934
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||||||||| ||||||| |
|
|
| T |
4716886 |
tttggcattggtccatgtactttgtaaaaatattggtattgatccctct |
4716934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 8144899 - 8144863
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8144899 |
attggtccctgcactttgtaaaaatattgatattggt |
8144863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 15440705 - 15440741
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15440705 |
attggtccctgcactttgtaaaaatattgatattggt |
15440741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 17964874 - 17964838
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17964874 |
attggtccctgcactttgtaaaaatattgatattggt |
17964838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 18036408 - 18036444
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18036408 |
attggtccctgcactttgtaaaaatattgatattggt |
18036444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 18705751 - 18705715
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18705751 |
attggtccctgcactttgtaaaaatattgatattggt |
18705715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 20166470 - 20166418
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
20166470 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
20166418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 22619675 - 22619639
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22619675 |
attggtccctgcactttgtaaaaatattgatattggt |
22619639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 23592489 - 23592541
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
23592489 |
gtgtcattggtccctgcactttcatcagattttgatattggtccctgcacttt |
23592541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 23592708 - 23592672
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23592708 |
attggtccctgcactttgtaaaaatattgatattggt |
23592672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 23910304 - 23910356
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||||||| |||||| |
|
|
| T |
23910304 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctacacttt |
23910356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 25945554 - 25945518
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25945554 |
attggtccctgcactttgtaaaaatattgatattggt |
25945518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 26408646 - 26408698
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
26408646 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
26408698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 27858397 - 27858449
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
27858397 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
27858449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 27858711 - 27858659
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
27858711 |
gtgtcattggtccctgcattttcatcagattttggtattggtccctgcacttt |
27858659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 31912908 - 31912872
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31912908 |
attggtccctgcactttgtaaaaatattgatattggt |
31912872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 32792587 - 32792551
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32792587 |
attggtccctgcactttgtaaaaatattgatattggt |
32792551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 38245049 - 38245013
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38245049 |
attggtccctgcactttgtaaaaatattgatattggt |
38245013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 39412307 - 39412343
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39412307 |
attggtccctgcactttgtaaaaatattgatattggt |
39412343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 39412523 - 39412471
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
39412523 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
39412471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 582 - 625
Target Start/End: Complemental strand, 3023866 - 3023823
Alignment:
| Q |
582 |
ggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
3023866 |
ggtccctgcattttgtaaaagtattggtatcggtccctctgtta |
3023823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 573 - 616
Target Start/End: Original strand, 15440588 - 15440631
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
||||| ||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
15440588 |
tttgaaatttgttcctgcactttgtaaaaatattggtattggtc |
15440631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 591 - 625
Target Start/End: Complemental strand, 974154 - 974120
Alignment:
| Q |
591 |
actttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
974154 |
actttgtaaaaatattggtattgatccctctgtta |
974120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 2268593 - 2268551
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| ||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
2268593 |
attgatccttgcactttgtaaaaatattgatattggtccctct |
2268551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 5907599 - 5907553
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||| || |||||||| |
|
|
| T |
5907599 |
attggtccttgcattttgtaaaaatattggtattgatctctctgtta |
5907553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 617
Target Start/End: Original strand, 5950608 - 5950646
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5950608 |
attggtccctgcactttgtaaagttattggtattggtcc |
5950646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 587 - 621
Target Start/End: Original strand, 30491979 - 30492013
Alignment:
| Q |
587 |
ctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30491979 |
ctgcactttgtaaaaatattggtattggttcctct |
30492013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 32792668 - 32792626
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
32792668 |
attgatccctgcattttgtaaaaatattggtattggttcctct |
32792626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 578 - 615
Target Start/End: Complemental strand, 3023625 - 3023588
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
3023625 |
cattggcccctgcactttgtaaaaatattgatattggt |
3023588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 583 - 619
Target Start/End: Complemental strand, 8144927 - 8144890
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaa-tattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8144927 |
gtccctgcactttgtaaaaaatattggtattggtccct |
8144890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 578 - 615
Target Start/End: Complemental strand, 13667627 - 13667590
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
13667627 |
cattagtctctgcactttgtaaaaatattggtattggt |
13667590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 974054 - 974018
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
974054 |
attggtccatgcactttgtaaaaatattgatattggt |
974018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 2033925 - 2033961
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2033925 |
attggtccctgcactttgtaaaaatattaatattggt |
2033961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 2268236 - 2268288
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||| |||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
2268236 |
gtgtcattagtccctgcactttcatcagattttggcattggtccctgcacttt |
2268288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 2268481 - 2268445
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
2268481 |
attggtctctgcactttgtaaaaatattgatattggt |
2268445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 5214454 - 5214490
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
5214454 |
attggtccctgaactttgtaaaaatattgatattggt |
5214490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 5907486 - 5907450
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
5907486 |
attggtccctgcattttgtaaaaatattgatattggt |
5907450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 5950639 - 5950675
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
5950639 |
attggtccatgcactttgtaaaactattggtattggt |
5950675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 573 - 617
Target Start/End: Complemental strand, 5950799 - 5950755
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||| ||||||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
5950799 |
tttggcattggtccttacactttgtaaaaatattggtcttggtcc |
5950755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 8343223 - 8343259
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
8343223 |
attggtccttgcactttgtaaaaatattgatattggt |
8343259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 8343433 - 8343381
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||| |||||||||| |
|
|
| T |
8343433 |
gtgtcattggtccctgcactttcatcagattttggcattggttcctgcacttt |
8343381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 615
Target Start/End: Complemental strand, 9177113 - 9177081
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
9177113 |
gtccctgcactttgtaaaattattggtattggt |
9177081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 11062503 - 11062539
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
11062503 |
attggtccatgcactttgtaaaaatattgatattggt |
11062539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 13198140 - 13198100
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13198140 |
attgttccttgcactttgtcaaaatattggtattggtccct |
13198100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 13198288 - 13198236
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||| |||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
13198288 |
gtgttattggtccttgcactttcatcagattttggcattggtccctgcacttt |
13198236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 15443023 - 15442971
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||| |||||||| |
|
|
| T |
15443023 |
gtgtcattggtccctgcactttcatcagattttggcattggtccttgcacttt |
15442971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 16968788 - 16968824
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
16968788 |
attggtcccttcactttataaaaatattggtattggt |
16968824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 16968868 - 16968904
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
16968868 |
attgatccctgcactttgtaaaaatattgatattggt |
16968904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 16969089 - 16969037
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||| ||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
16969089 |
gtgtcattgatccctgcactttcatcagattttggcattggtccctgcacttt |
16969037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 18705532 - 18705584
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
18705532 |
gtgtcattggtccctgcactttcatcagattttggtattggtccctgcacttt |
18705584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 23910524 - 23910488
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
23910524 |
attggtccttgcactttgtaaaaatattgatattggt |
23910488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 547 - 595
Target Start/End: Original strand, 25945342 - 25945390
Alignment:
| Q |
547 |
cattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
25945342 |
cattggtccctgcactttcatcagattttggcattggtccctgcacttt |
25945390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 26408862 - 26408826
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
26408862 |
attggtccctccactttgtaaaaatattgatattggt |
26408826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 27858616 - 27858580
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
27858616 |
attggtccctgcattttgtaaaaatattgatattggt |
27858580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 32792372 - 32792424
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||| ||| ||||||| |||||||| ||||||||| |
|
|
| T |
32792372 |
gtgtcattggtccctgcacttttatcaaattttggcattggtctctgcacttt |
32792424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 38790103 - 38790139
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38790103 |
attggtccgtgtactttgtaaaaatattggtattggt |
38790139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 38790134 - 38790170
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
38790134 |
attggttcctgcactttgtaaaaatattgatattggt |
38790170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 2e-29; HSPs: 87)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 2232741 - 2232823
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2232741 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
2232823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 41441423 - 41441505
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41441423 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
41441505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 4528959 - 4528907
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4528959 |
tttgacattggtccctgcactttgtaaaaatattagtattggtccctctgtta |
4528907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 42686335 - 42686283
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42686335 |
tttgacattggtccatgcactttgtaaaaatattggtattggtccctctgtta |
42686283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 621
Target Start/End: Original strand, 7050537 - 7050585
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7050537 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtccctct |
7050585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 7050870 - 7050818
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7050870 |
tttggcattggtccctgaactttgtaaaaatattggtattggtccctctgtta |
7050818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 10495790 - 10495842
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10495790 |
tttggcattggtccctgcactttgtaaaaatattggtattagtccctctgtta |
10495842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 17696678 - 17696730
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17696678 |
tttggcattggtcactgcactttgtaaaaatattggtattggtccctctgtta |
17696730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 37406217 - 37406165
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37406217 |
tttggcattggtccttgcactttgtaaaaatattggtattggtccctctgtta |
37406165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 2705236 - 2705282
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2705236 |
attggtccatgcactttgtaaaaatattggtattggtccctctgtta |
2705282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 7050628 - 7050670
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7050628 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
7050670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 10496029 - 10495983
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10496029 |
attgttccctgcactttgtaaaaatattggtattggtccctctgtta |
10495983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 26695745 - 26695699
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26695745 |
attggtccctgcactttgtaaaaatattggtattggtccctttgtta |
26695699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 573 - 622
Target Start/End: Complemental strand, 2705484 - 2705435
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
2705484 |
tttgacattggtccatacactttgtaaaaatattggtattggtccctctg |
2705435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 573 - 622
Target Start/End: Complemental strand, 7678586 - 7678537
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7678586 |
tttggcattggtccctgcactttgtaaaaatattgatattggtccctctg |
7678537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 32923791 - 32923840
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32923791 |
tttggcattgatccctgcactttgtaaaaatattggtattggtccctctg |
32923840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 544 - 625
Target Start/End: Original strand, 42686033 - 42686114
Alignment:
| Q |
544 |
tgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||| ||| |||| ||||||| |||||||||||||||||| |||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
42686033 |
tgtcattagtctctgcactttcatcagattttgacattggtccctacactttgtaaaaatattgatattggttcctttgtta |
42686114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 2057068 - 2057020
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2057068 |
tttgaaattggtccctgtactttgtaaaaatattggtattggtccctct |
2057020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 9855375 - 9855427
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9855375 |
tttggcattggtctctgtactttgtaaaaatattggtattggtccctctgtta |
9855427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 10837424 - 10837384
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10837424 |
attggtccctgcactttgtaaaaatattggtattggtccct |
10837384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 10837513 - 10837465
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10837513 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtctctct |
10837465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 580 - 623
Target Start/End: Original strand, 27696771 - 27696814
Alignment:
| Q |
580 |
ttggtccctgcactttgtaaaaatattggtattggtccctctgt |
623 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27696771 |
ttggtccttgcactttgtaaaaatattggtattggtccctctgt |
27696814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 573 - 624
Target Start/End: Original strand, 43857531 - 43857582
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtt |
624 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43857531 |
tttggcattggtctctgtactttgtaaaaatattggtattggtccctctgtt |
43857582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 9855645 - 9855599
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9855645 |
attgatccctacactttgtaaaaatattggtattggtccctctgtta |
9855599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 26695482 - 26695528
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26695482 |
attggtccctacactttgtaaaaatattggtatcggtccctctgtta |
26695528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 27697006 - 27696968
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27697006 |
attggtccctgcactttgtaaaaatattggtattggtcc |
27696968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 30795035 - 30794997
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30795035 |
attggtccctgcactttgtaaaaatattggtattggtcc |
30794997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 30795117 - 30795075
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30795117 |
attggtccttgcactttgtaaaaatattggtattggtccctct |
30795075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 32538848 - 32538894
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32538848 |
attggtctctgcactttgtaaaaatattgatattggtccctctgtta |
32538894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 34181228 - 34181270
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34181228 |
attggtccctgcactttgtaaaaatattggtattgatccctct |
34181270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 37405946 - 37405988
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37405946 |
attggtccttgcactttgtaaaaatattggtattggtccctct |
37405988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 43857794 - 43857752
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43857794 |
attggtccctgcactttgtaaaaatattagtattggtccctct |
43857752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 574 - 619
Target Start/End: Original strand, 42216405 - 42216450
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42216405 |
ttgatattggtccctgcattttgtaaaaatattggtattggtccct |
42216450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 579 - 616
Target Start/End: Complemental strand, 43857709 - 43857672
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43857709 |
attggtccctgcactttgtaaaaatattggtattggtc |
43857672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 2056788 - 2056840
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
2056788 |
tttggcattggtccctgcactttgtaaaaatattgaaattggtccctttgtta |
2056840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 583 - 619
Target Start/End: Original strand, 7230127 - 7230163
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7230127 |
gtccctgcactttgtaaaaatattggtattggtccct |
7230163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 7230313 - 7230261
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
7230313 |
tttggcattggtccctgtactttgtaaaaatattggtattgatctctctgtta |
7230261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 7678645 - 7678593
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
7678645 |
gtgtcattggtcgatgcactttcatcaaattttggcattggtccctgcacttt |
7678593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 583 - 619
Target Start/End: Complemental strand, 9855560 - 9855524
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9855560 |
gtccctgcactttgtaaaaatattggtattggtccct |
9855524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 10837233 - 10837285
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||| || ||||| |
|
|
| T |
10837233 |
tttggcattggtccctgcactttgtaaaaatattggtatcggtctctatgtta |
10837285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 17696619 - 17696671
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
17696619 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctgcacttt |
17696671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 32539032 - 32538992
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32539032 |
attggtccctgtactttgtaaaaatattggtattggtccct |
32538992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 34181312 - 34181352
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34181312 |
attggtccctgtactttgtaaaaatattggtattggtccct |
34181352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 34181477 - 34181426
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
34181477 |
tttggcattggtccctgcactttataaaaata-tggtattggtccctctgtta |
34181426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 42216601 - 42216553
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
42216601 |
tttggcattggtctctgcactttgtaaaaatattggtattggtcactct |
42216553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 42216660 - 42216608
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
42216660 |
gtgtcattggtccctgcactttcatcggattttggcattggtccctgcacttt |
42216608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 2056980 - 2056942
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2056980 |
attggtccctgtactttgtaaaaatattggtattggtcc |
2056942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 7230043 - 7230089
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
7230043 |
attgatccctgcattttgtaaaaatattgatattggtccctctgtta |
7230089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 7678348 - 7678394
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
7678348 |
attggtctctgcactttgtaaaaatattggcattgatccctctgtta |
7678394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 32539114 - 32539072
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32539114 |
attgatccatgcactttgtaaaaatattggtattggtccctct |
32539072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 42216329 - 42216371
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42216329 |
attggtcctcgcactttgtaaaaatattggtattggtccctct |
42216371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 574 - 619
Target Start/End: Original strand, 26695556 - 26695601
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
26695556 |
ttgatattggtccctacactttgtaaaattattggtattggtccct |
26695601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 586 - 619
Target Start/End: Original strand, 37406035 - 37406068
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37406035 |
cctgcactttgtaaaaatattggtattggtccct |
37406068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 2232962 - 2232922
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
2232962 |
attggtctctgcactttgtaaaaatattgatattggtccct |
2232922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 7050713 - 7050749
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7050713 |
attggtccctgcactttgtaaaaatattgatattggt |
7050749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 7050929 - 7050877
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
7050929 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
7050877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 7230154 - 7230190
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7230154 |
attggtccctgcactttgtaaaaatattgatattggt |
7230190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 9855533 - 9855497
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9855533 |
attggtccctgcactttgtaaaaatattgatattggt |
9855497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 10837175 - 10837227
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
10837175 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
10837227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 10837393 - 10837357
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10837393 |
attggtccctgcactttgtaaaaatattgatattggt |
10837357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 26695592 - 26695628
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26695592 |
attggtccctgcactttgtaaaactattggtattggt |
26695628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 27696705 - 27696757
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
27696705 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
27696757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 30794816 - 30794868
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
30794816 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
30794868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 32539001 - 32538965
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32539001 |
attggtccctgcactttgtaaaaatattgatattggt |
32538965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 32923952 - 32923916
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32923952 |
attggtccctgcactttgtaaaaatattgatattggt |
32923916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 34181343 - 34181379
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34181343 |
attggtccctgcactttgtaaaaatattgatattggt |
34181379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 34181536 - 34181484
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
34181536 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
34181484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 37406059 - 37406095
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37406059 |
attggtccctgcactttgtaaaaatattgatattggt |
37406095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 41441611 - 41441575
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41441611 |
attggtccctgcactttgtaaaaatattgatattggt |
41441575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 42216441 - 42216477
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42216441 |
attggtccctgcactttgtaaaaatattgatattggt |
42216477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 42686145 - 42686181
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42686145 |
attggtccctgcactttgtaaaaatattgatattggt |
42686181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 591
Target Start/End: Original strand, 43857472 - 43857520
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgca |
591 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
43857472 |
gtgtcattggtccctgcactttcatcaaattttgacattggttcctgca |
43857520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 543 - 590
Target Start/End: Complemental strand, 4529020 - 4528973
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgc |
590 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||||||||| |
|
|
| T |
4529020 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctgc |
4528973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 544 - 595
Target Start/End: Original strand, 10495732 - 10495783
Alignment:
| Q |
544 |
tgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||| ||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
10495732 |
tgtcattgatccctgcactttcatcagattttgacattggtccctgcacttt |
10495783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 574 - 612
Target Start/End: Complemental strand, 2232936 - 2232898
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtatt |
612 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
2232936 |
ttgatattggtccctgcactttgtaaaaatattgatatt |
2232898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 17696939 - 17696897
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
17696939 |
attggtcactgcactttgtaaaaatattagtattggtctctct |
17696897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 583 - 625
Target Start/End: Complemental strand, 43921698 - 43921656
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||| |||| |
|
|
| T |
43921698 |
gtccctgcactttgtaaaaaaattgttattggtccctccgtta |
43921656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 574 - 615
Target Start/End: Original strand, 7678424 - 7678465
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
7678424 |
ttgatattggtccttgcactttgtaaaaatattgatattggt |
7678465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 574 - 615
Target Start/End: Complemental strand, 27696930 - 27696889
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
27696930 |
ttgatattggtctctgcactttgtaaaaatattgatattggt |
27696889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 2705543 - 2705491
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||| ||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
2705543 |
gtgtcattgatccctgcactttcatcagattttggcattggtccctgcacttt |
2705491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 4528799 - 4528835
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
4528799 |
attggtccctgcacttagtaaaaatattgatattggt |
4528835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 9855316 - 9855368
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| || | ||||||| |||||| |||||||||||||||||| |
|
|
| T |
9855316 |
gtgtcattggtccctgtactttcatcagattttggcattggtccctgcacttt |
9855368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 615
Target Start/End: Complemental strand, 17696822 - 17696790
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
17696822 |
gtccctgcactttgtaaaaatattgatattggt |
17696790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 17696857 - 17696817
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
17696857 |
attggtccttgcactttataaaaatattggtattcgtccct |
17696817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 32923733 - 32923785
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||| ||||||||| |
|
|
| T |
32923733 |
gtgtcattggtccctgcactttcatcagattttggcattggtctctgcacttt |
32923785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 41441642 - 41441602
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
41441642 |
attggtctctgcactttgaaaaaatattagtattggtccct |
41441602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 43857678 - 43857642
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
43857678 |
attggtctctgcactttgtaaaaatattgatattggt |
43857642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 7e-29; HSPs: 154)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 88 - 209
Target Start/End: Original strand, 36183496 - 36183617
Alignment:
| Q |
88 |
gtggatttgtatatatggagaaatgtattgcgatgacggtgatgtaaatgacaatatttaactttttctttatttcgaaaaatgaaaatcacaaactgta |
187 |
Q |
| |
|
|||||| ||| ||||||||| || ||||||| |||| |||||||||| || |||||||||||||||||||| |||| ||||| ||||||| ||||||||| |
|
|
| T |
36183496 |
gtggatctgtgtatatggaggaaggtattgcaatgaaggtgatgtaattggcaatatttaactttttctttctttctaaaaacgaaaatcgcaaactgta |
36183595 |
T |
 |
| Q |
188 |
ttttacaagaggaacatgagaa |
209 |
Q |
| |
|
||||| |||| ||||||||||| |
|
|
| T |
36183596 |
ttttataagatgaacatgagaa |
36183617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 1366677 - 1366595
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1366677 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
1366595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 47672009 - 47672091
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47672009 |
gtgtcattggtccctgcactttcatcagatttaggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
47672091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 2730804 - 2730856
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2730804 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
2730856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 5132676 - 5132624
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5132676 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
5132624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 15875159 - 15875107
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15875159 |
tttgacattggtccctgcactttgtaaaaatattggcattggtccctctgtta |
15875107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 29548868 - 29548816
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29548868 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
29548816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 38717675 - 38717623
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38717675 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
38717623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 39759019 - 39759071
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39759019 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
39759071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 39764373 - 39764425
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39764373 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
39764425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 45950971 - 45951023
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45950971 |
tttgacattggtccctgcactttgtaaaaatattggtattggtctctctgtta |
45951023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 578 - 625
Target Start/End: Original strand, 47647931 - 47647978
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47647931 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
47647978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 557 - 619
Target Start/End: Original strand, 25378711 - 25378773
Alignment:
| Q |
557 |
tgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378711 |
tgcactttcatcagattttggcattggtccctgcactttgtaaaaatattggtattggtccct |
25378773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 29715428 - 29715509
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||| | |||| ||||||| |||| | |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29715428 |
gtgtcattggttcttgcactttcatcatatttgg-cattggtccctgtactttgtaaaaatattggtattggtccctctgtta |
29715509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 32486928 - 32486977
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32486928 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctg |
32486977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 40124849 - 40124898
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40124849 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctg |
40124898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 1342500 - 1342552
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1342500 |
tttggcattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
1342552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 7838677 - 7838729
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
7838677 |
tttgacattggtccctgcattttgtaaaaatattggtattggtctctctgtta |
7838729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 25378952 - 25378900
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25378952 |
tttggcattggtccctgcactttgtaaaaatattgttattggtccctctgtta |
25378900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 30056996 - 30057048
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30056996 |
tttggcattggtccttgcactttgtaaaaatattggtattggtccctctgtta |
30057048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 36466004 - 36466056
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36466004 |
tttggcattggtccctgcactttgtaaaaatattggtattgatccctctgtta |
36466056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 38019310 - 38019262
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38019310 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtccctct |
38019262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 39759266 - 39759214
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39759266 |
tttggcattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
39759214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 617
Target Start/End: Original strand, 49628194 - 49628238
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49628194 |
tttgacattggtccctgcactttgtaaaaatattggtattggtcc |
49628238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 52346297 - 52346349
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52346297 |
tttgacattggtctctgcactttgtaaaaatattggtattagtccctctgtta |
52346349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 1342772 - 1342730
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1342772 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
1342730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 1366377 - 1366419
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1366377 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
1366419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 573 - 619
Target Start/End: Original strand, 2931029 - 2931075
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2931029 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccct |
2931075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 2937117 - 2937075
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937117 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
2937075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 23253665 - 23253623
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23253665 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
23253623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 28486694 - 28486736
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28486694 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
28486736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 28838175 - 28838221
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28838175 |
attggttcctgcactttgtaaaaatattggtattggtccctctgtta |
28838221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 573 - 619
Target Start/End: Complemental strand, 28838447 - 28838401
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28838447 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccct |
28838401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 573 - 619
Target Start/End: Complemental strand, 38291343 - 38291297
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38291343 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccct |
38291297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 38872584 - 38872626
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38872584 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
38872626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 44519679 - 44519637
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44519679 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
44519637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 45951244 - 45951202
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45951244 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
45951202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 47672283 - 47672241
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47672283 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
47672241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 50755999 - 50755953
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50755999 |
attggtccctgcactttgtaaaaatattggtattagtccctctgtta |
50755953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 574 - 619
Target Start/End: Original strand, 14291400 - 14291445
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14291400 |
ttgatattggtccctgcactttgtaaaaatattggtattggtccct |
14291445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 1342690 - 1342650
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1342690 |
attggtccctgcactttgtaaaaatattggtattggtccct |
1342650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 5904882 - 5904934
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5904882 |
tttggcattggtccatgcactttgtaaaaatattggtattggtccctcggtta |
5904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 14556083 - 14556135
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14556083 |
tttggcattggtccttgtactttgtaaaaatattggtattggtccctctgtta |
14556135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 23253393 - 23253445
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23253393 |
tttggcattagtccatgcactttgtaaaaatattggtattggtccctctgtta |
23253445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 23253584 - 23253544
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23253584 |
attggtccctgcactttgtaaaaatattggtattggtccct |
23253544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 25378764 - 25378804
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25378764 |
attggtccctgcactttgtaaaaatattggtattggtccct |
25378804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 28486776 - 28486816
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28486776 |
attggtccctgcactttgtaaaaatattggtattggtccct |
28486816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 28838257 - 28838297
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28838257 |
attggtccctgcactttgtaaaaatattggtattggtccct |
28838297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 29548677 - 29548717
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29548677 |
attggtccctgcactttgtaaaaatattggtattggtccct |
29548717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 36302496 - 36302548
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36302496 |
tttggcattggtccctgtactttgtaaaaatattggtattggttcctctgtta |
36302548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 38717483 - 38717523
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38717483 |
attggtccctgcactttgtaaaaatattggtattggtccct |
38717523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 40125039 - 40124999
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40125039 |
attggtccctgcactttgtaaaaatattggtattggtccct |
40124999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 44519599 - 44519559
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44519599 |
attggtccctgcactttgtaaaaatattggtattggtccct |
44519559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 47648114 - 47648074
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47648114 |
attggtccctgcactttgtaaaaatattggtattggtccct |
47648074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 543 - 614
Target Start/End: Complemental strand, 32005754 - 32005684
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattgg |
614 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
32005754 |
gtgtcattggtccctgcactttcatcagattttggcattggttc-tgcactttgtaaaaatattggtattgg |
32005684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 578 - 625
Target Start/End: Original strand, 50755730 - 50755777
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
50755730 |
cattggtccctgcactttataaaaatattggtattggtctctctgtta |
50755777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 2731046 - 2731004
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2731046 |
attggtccctgcattttgtaaaaatattggtattggtccctct |
2731004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 5132500 - 5132542
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5132500 |
attggtccctgcactttgtaaaaatattggtattgatccctct |
5132542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 6782640 - 6782682
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6782640 |
attgatccctgcactttgtaaaaatattggtattggtccctct |
6782682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 14291325 - 14291367
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14291325 |
attgatccctgcactttgtaaaaatattggtattggtccctct |
14291367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 14556352 - 14556306
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14556352 |
attgatccctgcactttgtaaaaatattggtattgatccctctgtta |
14556306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 17077667 - 17077625
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17077667 |
attggtctctgcactttgtaaaaatattggtattggtccctct |
17077625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 32487201 - 32487155
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
32487201 |
attggtccctgcaatttgtaaaaatattggtattgatccctctgtta |
32487155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 617
Target Start/End: Original strand, 37351097 - 37351135
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37351097 |
attggtccctgcactttgtaaaaatattggtattggtcc |
37351135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 38717401 - 38717443
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38717401 |
attggtccctgcactttgtaaaaatattggtattggttcctct |
38717443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 39524345 - 39524391
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
39524345 |
attggtccctgcactttgtaaaaatattagtattagtccctctgtta |
39524391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 39950307 - 39950353
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
39950307 |
attggtccctgcactttgtaaaaatattggtattgatccatctgtta |
39950353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 573 - 615
Target Start/End: Original strand, 44396127 - 44396169
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44396127 |
tttgacattggtccctgcactttgtaaaaacattggtattggt |
44396169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 47648196 - 47648154
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47648196 |
attggtccctgtactttgtaaaaatattggtattggtccctct |
47648154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 583 - 621
Target Start/End: Complemental strand, 49628426 - 49628388
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49628426 |
gtccctgcactttgtaaaaatattggtattggtccctct |
49628388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 52346524 - 52346482
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52346524 |
attggtccatgcactttgtaaaaatattggtattggtccctct |
52346482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 582 - 619
Target Start/End: Original strand, 38872669 - 38872706
Alignment:
| Q |
582 |
ggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38872669 |
ggtccctgcactttgtaaaaatattggtattggtccct |
38872706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 582 - 619
Target Start/End: Complemental strand, 50755914 - 50755877
Alignment:
| Q |
582 |
ggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50755914 |
ggtccctgcactttgtaaaaatattggtattggtccct |
50755877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 1366457 - 1366497
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1366457 |
attggtccctgcactttgtaaaaatattggtattggcccct |
1366497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 5132735 - 5132683
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
5132735 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctgcacttt |
5132683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 6782721 - 6782761
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6782721 |
attggttcctgcactttgtaaaaatattggtattggtccct |
6782761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 6782906 - 6782854
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| ||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
6782906 |
tttggcattggtccttgcactttgcaaaaatattggtattggttcctctgtta |
6782854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 17077394 - 17077446
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
17077394 |
tttggcattggtccctgcactttgtaaaaatattggtattaatctctctgtta |
17077446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 17077585 - 17077545
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17077585 |
attggtccatgcactttgtaaaaatattggtattggtccct |
17077545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 621
Target Start/End: Original strand, 32005534 - 32005582
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
32005534 |
tttgaaattggtccctgcactttgtaaaaatattgatattagtccctct |
32005582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 36466193 - 36466153
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36466193 |
attggtccctgcactttgtagaaatattggtattggtccct |
36466153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 37351014 - 37351050
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37351014 |
attggtccctgcactttgtaaaaatattggtattggt |
37351050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 617
Target Start/End: Complemental strand, 38872853 - 38872809
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38872853 |
tttggcattggtccctgcacttcgtaaaaatattggtattggtcc |
38872809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 38872913 - 38872861
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
38872913 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctgcacttt |
38872861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 44396323 - 44396283
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44396323 |
attggtcactgcactttgtaaaaatattggtattggtccct |
44396283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 44519408 - 44519460
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44519408 |
tttggcattgatccttgcactttgtaaaaatattagtattggtccctctgtta |
44519460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 578 - 617
Target Start/End: Complemental strand, 14291589 - 14291550
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14291589 |
cattggtctctgcactttgtaaaaatattggtattggtcc |
14291550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 573 - 620
Target Start/End: Complemental strand, 28486966 - 28486919
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctc |
620 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
28486966 |
tttggcattggtccttgcactttgtaaaaatattgatattggtccctc |
28486919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 587 - 625
Target Start/End: Complemental strand, 30057260 - 30057222
Alignment:
| Q |
587 |
ctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30057260 |
ctgcactttgtaaaaatattggtattgatccctctgtta |
30057222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 36302767 - 36302721
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36302767 |
attggtccttgtactttgtaaaaatattggtattgatccctctgtta |
36302721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 36466275 - 36466233
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36466275 |
attgatccctgtactttgtaaaaatattggtattggtccctct |
36466233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 38019226 - 38019188
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38019226 |
attggtccctgtactttgtaaaaatattggtattggtcc |
38019188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 578 - 615
Target Start/End: Complemental strand, 2937036 - 2936999
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2937036 |
cattggtccctgcactttgtaaaaatattgatattggt |
2936999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 586 - 619
Target Start/End: Complemental strand, 30057179 - 30057146
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30057179 |
cctgcactttgtaaaaatattggtattggtccct |
30057146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 1342441 - 1342493
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
1342441 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
1342493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 1342659 - 1342623
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1342659 |
attggtccctgcactttgtaaaaatattgatattggt |
1342623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 2930970 - 2931022
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
2930970 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
2931022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 5905041 - 5905005
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5905041 |
attggtccctgcactttgtaaaaatattgatattggt |
5905005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 5905072 - 5905032
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
5905072 |
attggtccctacactttgtaaaactattggtattggtccct |
5905032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 6782965 - 6782913
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
6782965 |
gtgtcattggtccttgcactttcatcagattttggcattggtccctgcacttt |
6782913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 14556025 - 14556077
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||| |||||||||||| |
|
|
| T |
14556025 |
gtgtcattggtccctgcactttcatcagattttgacattgatccctgcacttt |
14556077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 17077335 - 17077387
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
17077335 |
gtgtcattggtccttgcactttcatcatattttggcattggtccctgcacttt |
17077387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 17077554 - 17077518
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17077554 |
attggtccctgcactttgtaaaaatattgatattggt |
17077518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 23253553 - 23253517
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23253553 |
attggtccctgcactttgtaaaaatattgatattggt |
23253517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 25378795 - 25378831
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25378795 |
attggtccctgcactttgtaaaaatattgatattggt |
25378831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 28486807 - 28486843
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28486807 |
attggtccctgcactttgtaaaaatattgatattggt |
28486843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 28838288 - 28838324
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28838288 |
attggtccctgcactttgtaaaaatattgatattggt |
28838324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 32005620 - 32005656
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32005620 |
attggtccctgcactttgtaaaaatattgatattggt |
32005656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 581 - 617
Target Start/End: Complemental strand, 32487117 - 32487081
Alignment:
| Q |
581 |
tggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32487117 |
tggtccctgcagtttgtaaaaatattggtattggtcc |
32487081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 36302437 - 36302489
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| ||||||||| |||||||| |
|
|
| T |
36302437 |
gtgtcattggtccatgcactttcatcagattttggcattggtccatgcacttt |
36302489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 36465945 - 36465997
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
36465945 |
gtgtcattggtccctgcactttcatcagattttgaaattggtccctgcacttt |
36465997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 36466162 - 36466126
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36466162 |
attggtccctgcactttgtaaaaatattgatattggt |
36466126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 37351278 - 37351226
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| ||| |||||||||||||||| ||||| ||||||||||| |
|
|
| T |
37351278 |
tttggcattggtccatgcgctttgtaaaaatattgatattgatccctctgtta |
37351226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 38717514 - 38717550
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38717514 |
attggtccctgcactttgtaaaaatattgatattggt |
38717550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 38872697 - 38872733
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38872697 |
attggtccctgcactttgtaaaaatattgatattggt |
38872733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 39524278 - 39524330
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
39524278 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
39524330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 39950389 - 39950425
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39950389 |
attggtccctgcactttgtaaaaatattgatattggt |
39950425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 40124790 - 40124842
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| | || ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
40124790 |
gtgtcattggtccctacactttcatcaaattttgacattgatccctgcacttt |
40124842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 40125008 - 40124972
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40125008 |
attggtccctgcactttgtaaaaatattgatattggt |
40124972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 585 - 625
Target Start/End: Complemental strand, 40125116 - 40125076
Alignment:
| Q |
585 |
ccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
40125116 |
ccctgcactttgtaaaaatattggtattgatccatctgtta |
40125076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 44519568 - 44519532
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44519568 |
attggtccctgcactttgtaaaaatattgatattggt |
44519532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 45950912 - 45950964
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
45950912 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
45950964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 45951163 - 45951123
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
45951163 |
attggtccctgcactttgtaaaaatattgatattagtccct |
45951123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 47648083 - 47648047
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47648083 |
attggtccctgcactttgtaaaaatattgatattggt |
47648047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 49628354 - 49628318
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49628354 |
attggtccctgcactttgtaaaaatattgatattggt |
49628318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 50755886 - 50755850
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50755886 |
attggtccctgcactttgtaaaaatattgatattggt |
50755850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 52346445 - 52346409
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52346445 |
attggtccctgcattttgtaaaaatattggtattggt |
52346409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 548 - 595
Target Start/End: Original strand, 52346243 - 52346290
Alignment:
| Q |
548 |
attggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
52346243 |
attggtccatgcactttcatcagattttggcattggtccctgcacttt |
52346290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 29721424 - 29721386
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29721424 |
attggtccctgcactttgtaaaaatattaatattggtcc |
29721386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 549 - 595
Target Start/End: Complemental strand, 36726475 - 36726429
Alignment:
| Q |
549 |
ttggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||| |||||||||||| ||||||| | |||||||||||||||| |
|
|
| T |
36726475 |
ttggtccctgcattttcatctaattttggctttggtccctgcacttt |
36726429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 5904822 - 5904875
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatc-gaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
5904822 |
gtgtcattggtccctgcacttttatcagaattttggcattggtccctgcacttt |
5904875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 579 - 616
Target Start/End: Complemental strand, 7838866 - 7838829
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
7838866 |
attggtccctacactttgtaaaattattggtattggtc |
7838829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 583 - 616
Target Start/End: Complemental strand, 29715643 - 29715610
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
29715643 |
gtccctgcactttataaaaatattggtattggtc |
29715610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 582 - 615
Target Start/End: Complemental strand, 47672196 - 47672163
Alignment:
| Q |
582 |
ggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
47672196 |
ggtccctgcactttgtaaaaatattgatattggt |
47672163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 1366488 - 1366524
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
1366488 |
attggcccctgcactttgtaaaaatattgatattggt |
1366524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 2730964 - 2730928
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
2730964 |
attggtccctgtactttgtaaaaatattgatattggt |
2730928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 7838953 - 7838901
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| |||||||| | |||| | | ||||||||||||||||||||||||||| |
|
|
| T |
7838953 |
tttgaaattggtccatacactatatcaaaatattggtattggtccctctgtta |
7838901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 615
Target Start/End: Complemental strand, 14556237 - 14556205
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
14556237 |
gtccctgcactttgtaaaaatattgatattggt |
14556205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 619
Target Start/End: Complemental strand, 14556268 - 14556232
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
14556268 |
gtccctgtactttgtaaaaatattggtattagtccct |
14556232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 25379011 - 25378959
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||| ||||||||| |
|
|
| T |
25379011 |
gtgtcattggtccctgcactttcatcagattttggcattggtctctgcacttt |
25378959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 28487025 - 28486973
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| || ||| |||||||||||||||||| |
|
|
| T |
28487025 |
gtgtcattggtccctgcactttcatcagatattggcattggtccctgcacttt |
28486973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 607
Target Start/End: Complemental strand, 30057155 - 30057127
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattg |
607 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30057155 |
attggtccctgcactttgtaaaaatattg |
30057127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 32487088 - 32487052
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
32487088 |
attggtccatgcactttgtaaaaatattgatattggt |
32487052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 36302654 - 36302618
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
36302654 |
attggtctctgcactttgtaaaaatattgatattggt |
36302618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 37351128 - 37351164
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
37351128 |
attggtccatgcactttgtaaaaatattgatattggt |
37351164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 37351337 - 37351285
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||| |||||||| |
|
|
| T |
37351337 |
gtgtcattggtccctgcactttcatcagattttggcattggtccttgcacttt |
37351285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 38019195 - 38019159
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
38019195 |
attggtccttgcactttgtaaaaatattgatattggt |
38019159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 38717734 - 38717682
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||| |||||||| |
|
|
| T |
38717734 |
gtgtcattggtccctgcactttcatcagattttggcattggtccttgcacttt |
38717682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 39759107 - 39759143
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
39759107 |
attgatccctgcactttgtaaaaatattgatattggt |
39759143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 39764461 - 39764497
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
39764461 |
attgatccctgcactttgtaaaaatattgatattggt |
39764497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 573 - 609
Target Start/End: Complemental strand, 39950543 - 39950507
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggt |
609 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
39950543 |
tttggcattggtccctgcactttataaaaatattggt |
39950507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 44396292 - 44396256
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44396292 |
attggtccctgcactttgtaaaaatattaatattggt |
44396256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 591
Target Start/End: Original strand, 44519349 - 44519397
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgca |
591 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
44519349 |
gtgtcattggtctctgcattttcatcagattttggcattggtccctgca |
44519397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 47647867 - 47647919
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||| ||||||||| |
|
|
| T |
47647867 |
gtgtcattggtccctgcactttcatcagattttggcattggtctctgcacttt |
47647919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170 (Bit Score: 63; Significance: 5e-27; HSPs: 3)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 5859 - 5777
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5859 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
5777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 5583 - 5623
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5583 |
attggtccctgcactttgtaaaaatattggtattggtccct |
5623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 5669 - 5705
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5669 |
attggtccctgcactttgtaaaaatattgatattggt |
5705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 5e-27; HSPs: 115)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 41320376 - 41320458
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320376 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
41320458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 546 - 622
Target Start/End: Original strand, 21276347 - 21276423
Alignment:
| Q |
546 |
tcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21276347 |
tcattggtccctgcactttcatcaaattttggcattggtctctgcactttgtaaaaatattggtattggtccctctg |
21276423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 547 - 625
Target Start/End: Complemental strand, 38567837 - 38567759
Alignment:
| Q |
547 |
cattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||| |||| ||| ||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
38567837 |
cattggtccctgcacttttatcagattttgacattggtccctgcattttgtaaaaatattggtattagtccctctgtta |
38567759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 547 - 625
Target Start/End: Original strand, 47403892 - 47403970
Alignment:
| Q |
547 |
cattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| ||| |||| |||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47403892 |
cattgatccctgcactttcatcggattttggtattggtccctgcattttgtaaaaatattggtattggtccctctgtta |
47403970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 2765129 - 2765181
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2765129 |
tttgacattggtccctgcactttgtaaaaatattgatattggtccctctgtta |
2765181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 18732706 - 18732758
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18732706 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
18732758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 19276707 - 19276759
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19276707 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
19276759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 21766856 - 21766804
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21766856 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
21766804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 24000267 - 24000215
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24000267 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
24000215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 24164329 - 24164277
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24164329 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
24164277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 36508132 - 36508184
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36508132 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
36508184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 39102867 - 39102919
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39102867 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
39102919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 6626240 - 6626286
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626240 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
6626286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 21766582 - 21766628
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21766582 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
21766628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 38816568 - 38816522
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816568 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
38816522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 17356670 - 17356719
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17356670 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccttctg |
17356719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 573 - 622
Target Start/End: Complemental strand, 31657733 - 31657684
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31657733 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctg |
31657684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 6607704 - 6607756
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6607704 |
tttggcattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
6607756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 6626512 - 6626460
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626512 |
tttggcattggtcactgcactttgtaaaaatattggtattggtccctctgtta |
6626460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 21276609 - 21276557
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21276609 |
tttgaaattggtccctgcactttgtaaaaatattggtattgatccctctgtta |
21276557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 26174936 - 26174884
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26174936 |
tttggcattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
26174884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 31849742 - 31849690
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31849742 |
tttggcattggtccctgtactttgtaaaaatattggtattggtccctctgtta |
31849690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 44141755 - 44141703
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44141755 |
tttggcattggtccctgtactttgtaaaaatattggtattggtccctctgtta |
44141703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 47913466 - 47913414
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47913466 |
tttggcattggtctctgcactttgtaaaaatattggtattggtccctctgtta |
47913414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 543 - 610
Target Start/End: Complemental strand, 5850878 - 5850811
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggta |
610 |
Q |
| |
|
||||| ||||||||| || ||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5850878 |
gtgtcgttggtccatacactttcatcagattttggcattggtccctgcactttgtaaaaatattggta |
5850811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 552 - 619
Target Start/End: Complemental strand, 6607916 - 6607849
Alignment:
| Q |
552 |
gtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||| ||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6607916 |
gtccttgcactttcatcagattttggcattggtccctacactttgtaaaaatattggtattggtccct |
6607849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 21438315 - 21438361
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21438315 |
attggtccctgcactttgtaaaaatattgatattggtccctctgtta |
21438361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 31849505 - 31849551
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31849505 |
attggtccctgcactttgtaaaaatattggtattcgtccctctgtta |
31849551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 36508371 - 36508329
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36508371 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
36508329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 39103040 - 39102998
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39103040 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
39102998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 39385051 - 39385009
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39385051 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
39385009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 41320678 - 41320636
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320678 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
41320636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 47404189 - 47404147
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47404189 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
47404147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 1795508 - 1795560
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1795508 |
tttggcattgatccctgcactttgtaaaaatattggtattggtcactctgtta |
1795560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 6626321 - 6626361
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626321 |
attggtccctgcactttgtaaaaatattggtattggtccct |
6626361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 8952484 - 8952535
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8952484 |
tttggcattggtccctgcactttgtaaaa-tattggtattggtccctctgtta |
8952535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 8952671 - 8952631
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8952671 |
attggtccctgcactttgtaaaaatattggtattggtccct |
8952631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 10336273 - 10336313
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10336273 |
attggtccctgcactttgtaaaaatattggtattggtccct |
10336313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 10336463 - 10336411
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
10336463 |
tttggcattggtccctgcactttgtaaaaatattggtattgatctctctgtta |
10336411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 617
Target Start/End: Complemental strand, 18732971 - 18732927
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18732971 |
tttgtcattggtccctgcactttgtaaaaatattggtattggtcc |
18732927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 26174770 - 26174810
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26174770 |
attggtccctgcactttgtaaaaatattggtattggtccct |
26174810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 35193386 - 35193438
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35193386 |
tttggcattggttcctgcactttgtaaaaatattagtattggtccctctgtta |
35193438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 38816305 - 38816357
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38816305 |
tttggcattagtccctgcactttgtaaaaatattggtattggtccatctgtta |
38816357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 39384969 - 39384929
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39384969 |
attggtccctgcactttgtaaaaatattggtattggtccct |
39384929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 39997956 - 39997904
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39997956 |
tttggcattggaccctgcactttgtaaaaatattggtattgatccctctgtta |
39997904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 41320598 - 41320558
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41320598 |
attggtccctgcactttgtaaaaatattggtattggtccct |
41320558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 47404108 - 47404068
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47404108 |
attggtccctgcactttgtaaaaatattggtattggtccct |
47404068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 8952750 - 8952708
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8952750 |
attggtccctacactttgtaaaaatattggtattggtccctct |
8952708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 583 - 625
Target Start/End: Complemental strand, 17356938 - 17356896
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17356938 |
gtccctgcactttgtaaaaatattggtattgatccctctgtta |
17356896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 19276983 - 19276941
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19276983 |
attggtccctgcactttgtaaaaatattgatattggtccctct |
19276941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 24164088 - 24164130
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24164088 |
attggtccctgcactttgtaaaaatattggtattggtcactct |
24164130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 26174689 - 26174735
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
26174689 |
attggtccctgcactttgtaaaaatattggtattggtcactcagtta |
26174735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 31657492 - 31657538
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31657492 |
attgatccctgcactttgtaaaaatattggtattgatccctctgtta |
31657538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 39997718 - 39997760
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39997718 |
attggtccttgcactttgtaaaaatattggtattggtccctct |
39997760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 44141483 - 44141525
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44141483 |
attggtccctgcactttgtaaaaatattggtattgatccctct |
44141525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 48863358 - 48863404
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48863358 |
attgatccatgcactttgtaaaaatattggtattggtccctctgtta |
48863404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 579 - 616
Target Start/End: Complemental strand, 17356858 - 17356821
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17356858 |
attggtccctgcactttgtaaaaatattggtattggtc |
17356821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 18733029 - 18732977
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
18733029 |
gtgtcattggtccctgcattttcatcagattttgacattggtctctgcacttt |
18732977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 581 - 625
Target Start/End: Complemental strand, 21438578 - 21438534
Alignment:
| Q |
581 |
tggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21438578 |
tggtccctgtactttgtaaaaatattggtattggtccttctgtta |
21438534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 21766664 - 21766704
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21766664 |
attggtccttgcactttgtaaaaatattggtattggtccct |
21766704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 24000077 - 24000117
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24000077 |
attggtccctgcactttgtaaaaatattggtattgatccct |
24000117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 38816488 - 38816448
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38816488 |
attggtccctgcactttgtaaaaatattggtattggcccct |
38816448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 39384779 - 39384831
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
39384779 |
tttggcattggtccttgcactttgtaaaaatattggtattggttcatctgtta |
39384831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 583 - 619
Target Start/End: Original strand, 47913281 - 47913317
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47913281 |
gtccctgcactttgtaaaaatattggtattggtccct |
47913317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 579 - 618
Target Start/End: Complemental strand, 19276899 - 19276860
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccc |
618 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19276899 |
attggtccctgcactttataaaaatattggtattggtccc |
19276860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 582 - 617
Target Start/End: Original strand, 47913198 - 47913233
Alignment:
| Q |
582 |
ggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47913198 |
ggtccctgcactttgtaaaaatattggtattggtcc |
47913233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 10336193 - 10336235
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
10336193 |
attggtccctgtactttgtaaaaatattggtattcgtccctct |
10336235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 23999995 - 24000037
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
23999995 |
attggtcccggcactttgtaaaaatattggtattgatccctct |
24000037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 578 - 612
Target Start/End: Complemental strand, 35193578 - 35193544
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtatt |
612 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35193578 |
cattggtccctgcactttgtaaaaatattggtatt |
35193544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 35193658 - 35193616
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
35193658 |
attggtccttgtactttgtaaaaatattggtattggtccctct |
35193616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 574 - 615
Target Start/End: Original strand, 24164166 - 24164207
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24164166 |
ttgatattggtccctgcactttgtaaaaatattgatattggt |
24164207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 6607645 - 6607697
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
6607645 |
gtgtcattggtccctgcactttcatccgattttggcattggtccctgcacttt |
6607697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 6607858 - 6607822
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6607858 |
attggtccctgcactttgtaaaaatattgatattggt |
6607822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 6626352 - 6626388
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6626352 |
attggtccctgcactttgtaaaaatattgatattggt |
6626388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 6626571 - 6626519
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
6626571 |
gtgtcattggtccctgcactttcatccgattttggcattggtccctgcacttt |
6626519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 591
Target Start/End: Original strand, 17356612 - 17356660
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgca |
591 |
Q |
| |
|
||||||||||||| | || ||||||| |||||||||||||||||||||| |
|
|
| T |
17356612 |
gtgtcattggtccctacactttcatcaaattttgacattggtccctgca |
17356660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 18732793 - 18732829
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18732793 |
attggtccctgcactttgtaaaaatattgatattggt |
18732829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 19276648 - 19276700
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
19276648 |
gtgtcattggtccctgcactttcatcagattttgaaattggtccctgcacttt |
19276700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 21276533 - 21276497
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21276533 |
attggtccctgcactttgtaaaaatattgatattggt |
21276497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 21766695 - 21766731
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21766695 |
attggtccctgcactttgtaaaaatattgatattggt |
21766731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 24000326 - 24000274
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
24000326 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
24000274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 26174801 - 26174837
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26174801 |
attggtccctgcactttgtaaaaatattgatattggt |
26174837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 31657574 - 31657610
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31657574 |
attggtccctgcactttgtaaaaatattgatattggt |
31657610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 31657792 - 31657740
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
31657792 |
gtgtcattggtccctgcactttcatcaaattttagcattggtccctgcacttt |
31657740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 31849801 - 31849749
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
31849801 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
31849749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 35193327 - 35193379
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||| ||| |||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
35193327 |
gtgtcattgatccctgcactttcatcggattttggcattggtccctgcacttt |
35193379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 36508290 - 36508254
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36508290 |
attggtccctgcactttgtaaaaatattgatattggt |
36508254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 38567653 - 38567689
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38567653 |
attggtccctgcactttgtaaaaatattgatattggt |
38567689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 39384938 - 39384902
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39384938 |
attggtccctgcactttgtaaaaatattgatattggt |
39384902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 47404077 - 47404041
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47404077 |
attggtccctgcactttgtaaaaatattgatattggt |
47404041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 48863549 - 48863497
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
48863549 |
gtgtcattggtccttgcactttcatcagattttggcattggtccctgcacttt |
48863497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 613
Target Start/End: Complemental strand, 8952640 - 8952606
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8952640 |
attggtccctgcactttgtaaaaatattgatattg |
8952606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 583 - 617
Target Start/End: Original strand, 21438401 - 21438435
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
21438401 |
gtccctgcactttgtaaaaatattagtattggtcc |
21438435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 613
Target Start/End: Original strand, 39997799 - 39997833
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39997799 |
attggtccctgcactttgtaaaaatattgatattg |
39997833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 583 - 612
Target Start/End: Original strand, 44141567 - 44141596
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtatt |
612 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44141567 |
gtccctgcactttgtaaaaatattggtatt |
44141596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 579 - 612
Target Start/End: Original strand, 47913308 - 47913341
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtatt |
612 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
47913308 |
attggtccctgcactttgtaaaaatattgatatt |
47913341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 1795449 - 1795501
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||||||| |||||||| |
|
|
| T |
1795449 |
gtgtcattggtccctgcactttcatcaaattttggaattggtccatgcacttt |
1795501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 8952426 - 8952477
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
8952426 |
gtgtcattggtccctgcactttcatcagattttg-cattggtccctgcacttt |
8952477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 10336304 - 10336340
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
10336304 |
attggtccctgcaccttgtaaaaatattgatattggt |
10336340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 10336522 - 10336470
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
10336522 |
gtgtcattggtccctgcactttcatcagattttggcattagtccctgcacttt |
10336470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 17356827 - 17356791
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
17356827 |
attggtctctgcactttgtaaaaatattgatattggt |
17356791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 19276868 - 19276832
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
19276868 |
attggtcccagcactttgtaaaaatattgatattggt |
19276832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 21438428 - 21438464
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
21438428 |
attggtccatgcactttgtaaaaatattgatattggt |
21438464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 21438645 - 21438593
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||| ||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
21438645 |
gtgtcattgatccctgcactttcatcagattttggcattggtccctgcacttt |
21438593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 21766914 - 21766862
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| || | ||||||| |||||| |||||||||||||||||| |
|
|
| T |
21766914 |
gtgtcattggtccctgtactttcatcagattttggcattggtccctgcacttt |
21766862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 24000108 - 24000144
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
24000108 |
attgatccctgcactttgtaaaaatattgatattggt |
24000144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 24164388 - 24164336
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| | || ||||||| |||||| |||||||||||||||||| |
|
|
| T |
24164388 |
gtgtcattggtccctacactttcatcagattttggcattggtccctgcacttt |
24164336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 615
Target Start/End: Original strand, 31849588 - 31849620
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
31849588 |
gtccctgcactttgtaaaaatattgatattggt |
31849620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 38567872 - 38567820
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||| |||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
38567872 |
gtgtcactggtccctgcactttcatcagattttggcattggtccctgcacttt |
38567820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 38816246 - 38816298
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
38816246 |
gtgtcattggtccctgcactttcatcagattttggaattggtccctgcacttt |
38816298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 38816457 - 38816421
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
38816457 |
attggcccctgcactttgtaaaaatattgatattggt |
38816421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 39102808 - 39102860
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||| ||||||||| |
|
|
| T |
39102808 |
gtgtcattggtccctgcactttcatcagattttggcattggtctctgcacttt |
39102860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 39384721 - 39384773
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
39384721 |
gtgtcattggtccctgcactttcatcagattttggcattagtccctgcacttt |
39384773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 41320567 - 41320531
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
41320567 |
attggtccctgcgctttgtaaaaatattgatattggt |
41320531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 47913525 - 47913473
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||| |||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
47913525 |
gtgttattggtccctgcactttcatcagattttggcattggtccctgcacttt |
47913473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 5e-27; HSPs: 132)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 2098669 - 2098587
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2098669 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
2098587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 544 - 625
Target Start/End: Original strand, 32927720 - 32927801
Alignment:
| Q |
544 |
tgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927720 |
tgtcattggtccctgcactttcatcagattttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
32927801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 28625810 - 28625758
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28625810 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
28625758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 42434745 - 42434797
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42434745 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
42434797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 430864 - 430812
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
430864 |
tttgacattggtccttgcactttgtaaaaatattggtattggtccctctgtta |
430812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 970505 - 970557
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
970505 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
970557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 14102919 - 14102867
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14102919 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
14102867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 18478638 - 18478586
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18478638 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
18478586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 18707592 - 18707644
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18707592 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
18707644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 32504326 - 32504274
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504326 |
tttgacattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
32504274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 32654162 - 32654110
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32654162 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
32654110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 33850521 - 33850573
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33850521 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
33850573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 41186317 - 41186369
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41186317 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
41186369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 42814301 - 42814249
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42814301 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
42814249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 546 - 625
Target Start/End: Original strand, 3951960 - 3952039
Alignment:
| Q |
546 |
tcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||| || ||||| ||||||| ||||||||||||||| |||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3951960 |
tcattgatctatgcactttcatcagattttgacattggtctctgcactttgtaaaaatattagtattggtccatctgtta |
3952039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 543 - 606
Target Start/End: Original strand, 16265594 - 16265657
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatatt |
606 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16265594 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctgcactttgtaaaaatatt |
16265657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 578 - 625
Target Start/End: Original strand, 25251521 - 25251568
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25251521 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
25251568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 14102646 - 14102692
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14102646 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
14102692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 32653888 - 32653934
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32653888 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
32653934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 32928053 - 32928007
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32928053 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
32928007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 34826023 - 34825977
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826023 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
34825977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 3963121 - 3963170
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3963121 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctg |
3963170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 970783 - 970735
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
970783 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtccctct |
970735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 3963062 - 3963114
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3963062 |
gtgtcattggtccctgcattttcatcaaattttgacattggtccctgcacttt |
3963114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 4831463 - 4831411
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4831463 |
tttggcattggtccctgcactttgtaaaaatattagtattggtccctctgtta |
4831411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 4902690 - 4902742
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4902690 |
tttggcattggtccctgcactttgtaaaaatattgttattggtccctctgtta |
4902742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 4950088 - 4950140
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4950088 |
tttggcattggtccctgcactttgtaaaaatattgttattggtccctctgtta |
4950140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 8031364 - 8031312
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8031364 |
tttggcattggtccctgtactttgtaaaaatattggtattggtccctctgtta |
8031312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 11278309 - 11278257
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11278309 |
tttggcattggtccctgcactttgtaaaaatattggtattgatccctctgtta |
11278257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 14827841 - 14827789
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14827841 |
tttgacatcggtccctgcactttgtaaaaatattggtattggttcctctgtta |
14827789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 18907269 - 18907217
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18907269 |
tttggcattggttcctgcactttgtaaaaatattggtattggtccctctgtta |
18907217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 40691629 - 40691577
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40691629 |
tttggcattggtccatgcactttgtaaaaatattggtattggtccctctgtta |
40691577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 4902937 - 4902891
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4902937 |
attggtccctgcactttgtaaaaatatcggtattggtccctctgtta |
4902891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 11108746 - 11108704
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11108746 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
11108704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 18906998 - 18907044
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18906998 |
attggtccctacactttgtaaaaatattggtattggtccctctgtta |
18907044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 25263686 - 25263640
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25263686 |
attggtccatgcactttgtaaaaatattggtattggtccctctgtta |
25263640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 32504054 - 32504096
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504054 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
32504096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 33850793 - 33850751
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33850793 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
33850751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 580 - 621
Target Start/End: Original strand, 4831191 - 4831232
Alignment:
| Q |
580 |
ttggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4831191 |
ttggtccctgcactttgtaaaaatattggtattggtccctct |
4831232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 2098448 - 2098488
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2098448 |
attggtccctgcactttgtaaaaatattggtattggtccct |
2098488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 3952170 - 3952130
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3952170 |
attggtccctgcactttgtaaaaatattggtattggtccct |
3952130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 3952259 - 3952211
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3952259 |
tttgaaattggtccctgcactttgtaaaaatattggtattgatccctct |
3952211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 4902855 - 4902815
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4902855 |
attggtccctgcactttgtaaaaatattggtattggtccct |
4902815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 5674251 - 5674211
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5674251 |
attggtccctgcactttgtaaaaatattggtattggtccct |
5674211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 7900605 - 7900553
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7900605 |
tttggcattggtccctgtactttgtaaaaatattgctattggtccctctgtta |
7900553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 8031423 - 8031371
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8031423 |
gtgtcattggtccttgcattttcatcagattttgacattggtccctgcacttt |
8031371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 14102729 - 14102769
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14102729 |
attggtccctgcactttgtaaaaatattggtattggtccct |
14102769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 18707780 - 18707740
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18707780 |
attggtccctgcactttgtaaaaatattggtattggtccct |
18707740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 32504136 - 32504176
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504136 |
attggtccctgcactttgtaaaaatattggtattggtccct |
32504176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 32653971 - 32654011
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32653971 |
attggtccctgcactttgtaaaaatattggtattggtccct |
32654011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 32927939 - 32927899
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927939 |
attggtccctgcactttgtaaaaatattggtattggtccct |
32927899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 32927970 - 32927930
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32927970 |
attggtccctgcactttgtaaaaatattggtattggtccct |
32927930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 581 - 625
Target Start/End: Complemental strand, 41186582 - 41186538
Alignment:
| Q |
581 |
tggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41186582 |
tggtccctgtactttgtaaaaatattggtattggtccctctgtta |
41186538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 582 - 625
Target Start/End: Complemental strand, 3963358 - 3963315
Alignment:
| Q |
582 |
ggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3963358 |
ggtccctgcactttgtaaaaatattggtattgatccctctgtta |
3963315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 586 - 625
Target Start/End: Original strand, 7900340 - 7900379
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7900340 |
cctgcactttgtaaaaatattggtattggtccctctgtta |
7900379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 9777311 - 9777269
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9777311 |
attggtccctgcactttgtaaaaatattggtattgctccctct |
9777269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 34825756 - 34825802
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34825756 |
attggtccctacactttataaaaatattggtattggtccctctgtta |
34825802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 42813950 - 42813992
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42813950 |
attggtcccagcactttgtaaaaatattggtattggtccctct |
42813992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 588 - 625
Target Start/End: Complemental strand, 25251772 - 25251735
Alignment:
| Q |
588 |
tgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25251772 |
tgcactttgtaaaaatattggtattggtccctctgtta |
25251735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 4831272 - 4831312
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4831272 |
attgatccctgcactttgtaaaaatattggtattggtccct |
4831312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 4950030 - 4950082
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
4950030 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctgcacttt |
4950082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 621
Target Start/End: Original strand, 11108475 - 11108523
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
11108475 |
tttggcattggtccctgtactttgtaaaaatattggtattggttcctct |
11108523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 14102978 - 14102926
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||||| ||||||||| |
|
|
| T |
14102978 |
gtgtcattggtccctgcactttcatcaaattttgacattggtctctgcacttt |
14102926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 18478450 - 18478486
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18478450 |
attggtccctgcactttgtaaaaatattggtattggt |
18478486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 18907080 - 18907120
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18907080 |
attggtccctgcactttgtaaaattattggtattggtccct |
18907120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 28625620 - 28625660
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28625620 |
attggtccctgcactttgtacaaatattggtattggtccct |
28625660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 34825840 - 34825880
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34825840 |
attggtccctgcactttgtaaaattattggtattggtccct |
34825880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 39060559 - 39060595
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39060559 |
attggtccctgcactttgtaaaaatattggtattggt |
39060595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 39060716 - 39060664
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||| |||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39060716 |
tttggcattagtccatgcactttgtaaaaatattggtattggttcctctgtta |
39060664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 42814032 - 42814072
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42814032 |
attggtccctgcactttgtaaaaatataggtattggtccct |
42814072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 573 - 619
Target Start/End: Original strand, 9777040 - 9777086
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
9777040 |
tttggcattggtccctgcactttgtataaatattggcattggtccct |
9777086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 18707862 - 18707820
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18707862 |
attgatccttgcactttgtaaaaatattggtattggtccctct |
18707820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 39060480 - 39060526
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
39060480 |
attggtccatgcactttgtaaacatattggtattggtccatctgtta |
39060526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 586 - 623
Target Start/End: Original strand, 8031153 - 8031190
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtccctctgt |
623 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8031153 |
cctgcactttgtaaaaatattggtattagtccctctgt |
8031190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 573 - 618
Target Start/End: Original strand, 14827566 - 14827611
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccc |
618 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
14827566 |
tttgaaattggtccctgcactttgtaaaagtattagtattggtccc |
14827611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 586 - 619
Target Start/End: Complemental strand, 16265703 - 16265670
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16265703 |
cctgcactttgtaaaaatattggtattggtccct |
16265670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 579 - 623
Target Start/End: Complemental strand, 19591694 - 19591650
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgt |
623 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| || |||| |
|
|
| T |
19591694 |
attggtccctgcactttgtaaaaatactggtattggttccnctgt |
19591650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 430729 - 430765
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
430729 |
attggtccctgcactttgtaaaaatattgatattggt |
430765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 430923 - 430871
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
430923 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
430871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 970696 - 970656
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
970696 |
attggtccctgaactttgtaaaaatattggtattagtccct |
970656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 2098479 - 2098515
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2098479 |
attggtccctgcactttgtaaaaatattgatattggt |
2098515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 4831303 - 4831339
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4831303 |
attggtccctgcactttgtaaaaatattgatattggt |
4831339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 4831522 - 4831470
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
4831522 |
gtgtcattggtccctgcactttcatcatattttgacatttgtccctgcacttt |
4831470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 4902632 - 4902684
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
4902632 |
gtgtcattggtccctgcactttcatcagattttgtcattggtccctgcacttt |
4902684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 4903002 - 4902950
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
4903002 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
4902950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 583 - 619
Target Start/End: Original strand, 7900421 - 7900457
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7900421 |
gtccatgcactttgtaaaaatattggtattggtccct |
7900457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 7900448 - 7900484
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7900448 |
attggtccctgcactttgtaaaaatattgatattggt |
7900484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 9776980 - 9777032
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
9776980 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
9777032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 573 - 617
Target Start/End: Complemental strand, 9791540 - 9791496
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||| ||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
9791540 |
tttggcattggtccctacactttataaaaatattggtattggtcc |
9791496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 14102760 - 14102796
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14102760 |
attggtccctgcactttgtaaaaatattgatattggt |
14102796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 14827652 - 14827692
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14827652 |
attgctccctgcactttgtaaaaatattagtattggtccct |
14827692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 18478481 - 18478517
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18478481 |
attggttcctgcactttgtaaaaatattggtattggt |
18478517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 18707502 - 18707554
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
18707502 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
18707554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 18707749 - 18707713
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18707749 |
attggtccctgcactttgtaaaaatattgatattggt |
18707713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 18907111 - 18907147
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18907111 |
attggtccctgcactttgtaaaactattggtattggt |
18907147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 25251675 - 25251639
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25251675 |
attggtccctgcactttgtaaaaatattgatattggt |
25251639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 25263580 - 25263544
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25263580 |
attggtccctgcactttgtaaaaatattgatattggt |
25263544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 28625651 - 28625687
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28625651 |
attggtccctgcactttgtaaaaatattgatattggt |
28625687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 557 - 601
Target Start/End: Original strand, 30415232 - 30415276
Alignment:
| Q |
557 |
tgcattttcatcgaattttgacattggtccctgcactttgtaaaa |
601 |
Q |
| |
|
|||| ||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
30415232 |
tgcactttcacccaattttgacattggtccctgcactttgtaaaa |
30415276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 32504167 - 32504203
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32504167 |
attggtccctgcactttgtaaaaatattgatattggt |
32504203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 32504385 - 32504333
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
32504385 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
32504333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 32654002 - 32654038
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32654002 |
attggtccctgcactttgtaaaaatattgatattggt |
32654038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 32654220 - 32654168
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
32654220 |
gtgtcattggtccctgcactttcatcagattttgatattggtccctgcacttt |
32654168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 32927908 - 32927872
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32927908 |
attggtccctgcactttgtaaaaatattgatattggt |
32927872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 33850712 - 33850672
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
33850712 |
attggtccctgaactttgtaaaaatattggtattagtccct |
33850672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 39060775 - 39060723
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
39060775 |
gtgtcattggtccctgcaattttatcagattttgacattggtccctgcacttt |
39060723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 40691470 - 40691506
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40691470 |
attggtccctgcactttgtaaaaatattgatattggt |
40691506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 40691688 - 40691636
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
40691688 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
40691636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 41186650 - 41186598
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||| ||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
41186650 |
gtgtcgttggtccctgcactttcatcagattttgacattggtccctgcacttt |
41186598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 42434904 - 42434868
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42434904 |
attggtcactgcactttgtaaaaatattggtattggt |
42434868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 45003001 - 45002965
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45003001 |
attggtccctgcactttgtaaaaatattgatattggt |
45002965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 45003087 - 45003040
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
45003087 |
tttgaaattggtcc-tgcactttgtaaaaatattggtattggtctctct |
45003040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 430646 - 430687
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
430646 |
attggtccctgcactttgt-aaaatattggtattggtctctct |
430687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 613
Target Start/End: Original strand, 2098366 - 2098400
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
2098366 |
attggtccatgcactttgtaaaaatattggtattg |
2098400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 609
Target Start/End: Complemental strand, 3952139 - 3952109
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggt |
609 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3952139 |
attggtccctgcactttgtaaaaatattggt |
3952109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 613
Target Start/End: Complemental strand, 4902824 - 4902790
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4902824 |
attggtccctgcactttgtaaaaatattgatattg |
4902790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 613
Target Start/End: Complemental strand, 4950222 - 4950188
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4950222 |
attggtccctgcactttgtaaaaatattgatattg |
4950188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 5674332 - 5674286
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| |||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
5674332 |
attggcccctgcactttgtaaaaatattggcatcggtccctccgtta |
5674286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 11278069 - 11278111
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
11278069 |
attgatccctgcactttgtaaaaatattgatattgatccctct |
11278111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 574 - 615
Target Start/End: Original strand, 11278144 - 11278185
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11278144 |
ttgatattggtccctgcactttgtaaaaatattaatattggt |
11278185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 579 - 612
Target Start/End: Original strand, 14827683 - 14827716
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtatt |
612 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
14827683 |
attggtccctgcactttgtaaaaatattgatatt |
14827716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 8031228 - 8031264
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
8031228 |
attggtccctgcgctttgtaaaaatattgatattggt |
8031264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 11108634 - 11108598
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
11108634 |
attgatccctgcactttgtaaaaatattgatattggt |
11108598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 619
Target Start/End: Complemental strand, 11108661 - 11108625
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
11108661 |
gtccctgcactttgtaaaaatattagtattgatccct |
11108625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 591
Target Start/End: Complemental strand, 14827900 - 14827852
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgca |
591 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||| |
|
|
| T |
14827900 |
gtgtcattggtccttgcactttcatcagattttggcattggtccctgca |
14827852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 18478697 - 18478645
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| || | ||||||| |||||| |||||||||||||||||| |
|
|
| T |
18478697 |
gtgtcattggtccctggactttcatcagattttggcattggtccctgcacttt |
18478645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 591
Target Start/End: Complemental strand, 28625871 - 28625823
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgca |
591 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
28625871 |
gtgtcattggtcgctgcactttcatcagattttgacattggtccctgca |
28625823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 34825871 - 34825907
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
34825871 |
attggtccctacactttgtaaaactattggtattggt |
34825907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 34826088 - 34826036
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
34826088 |
gtgtcattggtccctgcactttcatcagattttggtattggtccctgcacttt |
34826036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 587 - 619
Target Start/End: Original strand, 41186410 - 41186442
Alignment:
| Q |
587 |
ctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
41186410 |
ctgcactttgtaaaaatattggtattgctccct |
41186442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 42814360 - 42814308
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
42814360 |
gtgtcattggtccctgcactttcatcagattttggcattagtccctgcacttt |
42814308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 45002854 - 45002906
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| | ||||| |||||| |||||||||||||||||| |
|
|
| T |
45002854 |
gtgtcattggtccctgcactctcatcagattttggcattggtccctgcacttt |
45002906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 59; Significance: 1e-24; HSPs: 4)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 9595 - 9677
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9595 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcactttgtaaaaatattggtattagtccctctgtta |
9677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 9875 - 9833
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9875 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
9833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 9793 - 9753
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9793 |
attggtccctgcactttgtaaaaatattggtattggtccct |
9753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 9762 - 9726
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9762 |
attggtccctgcactttgtaaaaatattgatattggt |
9726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 1e-24; HSPs: 143)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 1614313 - 1614231
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1614313 |
gtgtcattggtccctgcactttcattaaattttgacattggtccttgcactttgtaaaaatattggtattggtctctctgtta |
1614231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 31317631 - 31317549
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31317631 |
gtgtcattggtctctgcactttcatcagattttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
31317549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 53940748 - 53940666
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53940748 |
gtgtcattggtccctgcacttttatcagattttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
53940666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 888135 - 888187
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
888135 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
888187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 15169010 - 15169062
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15169010 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
15169062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 23205766 - 23205818
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23205766 |
tttgacattggtccctgcactttgtaaaaatattggtattgatccctctgtta |
23205818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 29526317 - 29526369
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29526317 |
tttgacattggtctctgcactttgtaaaaatattggtattggtccctctgtta |
29526369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 41965484 - 41965432
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965484 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
41965432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 44589094 - 44589146
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44589094 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
44589146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 45226111 - 45226163
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45226111 |
tttgacattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
45226163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 578 - 625
Target Start/End: Original strand, 40005488 - 40005535
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40005488 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
40005535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 18436863 - 18436909
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18436863 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
18436909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 30560637 - 30560591
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30560637 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
30560591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 51716528 - 51716446
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||| |||| |||||| |||||| ||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51716528 |
gtgttattggtccctgcactttcattagattttggcattggtccctacactttgtaaaaatattggtattagtccctctgtta |
51716446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 572 - 621
Target Start/End: Original strand, 11021374 - 11021423
Alignment:
| Q |
572 |
ttttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11021374 |
ttttggcattggtccctgcactttgtaaaaatattggtattggtccctct |
11021423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 47690360 - 47690409
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47690360 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctg |
47690409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 8444973 - 8444921
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8444973 |
tttggcattggtccctgcactttgtaaaaatattggtattggcccctctgtta |
8444921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 13199041 - 13199093
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13199041 |
tttggcattggtccctgcactttttaaaaatattggtattggtccctctgtta |
13199093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 16335124 - 16335176
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16335124 |
tttggcattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
16335176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 32328379 - 32328331
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32328379 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtccctct |
32328331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 45311264 - 45311316
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45311264 |
tttggcattggtccctgcactttgtaaaaatattggtattgatccctctgtta |
45311316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 51892731 - 51892783
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51892731 |
tttggcattggtccctgcactttgtaaaaatattggtattggtctctctgtta |
51892783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 578 - 625
Target Start/End: Complemental strand, 321987 - 321940
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
321987 |
cattggtccctgcactttgtaaaaatattggcattggtccctctgtta |
321940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 578 - 621
Target Start/End: Complemental strand, 11021647 - 11021604
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11021647 |
cattggtccctgcactttgtaaaaatattggtattggtccctct |
11021604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 578 - 625
Target Start/End: Complemental strand, 18437127 - 18437080
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18437127 |
cattagtccctgcactttgtaaaaatattggtattggtccctctgtta |
18437080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 1614015 - 1614057
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1614015 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
1614057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 5814114 - 5814068
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5814114 |
attggtccctgcactttgtaaaaatattggtattgatccctctgtta |
5814068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 15169312 - 15169270
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15169312 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
15169270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 16335397 - 16335355
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16335397 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
16335355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 31317331 - 31317373
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31317331 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
31317373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 32384243 - 32384197
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32384243 |
attggtccctgcactttgtaaaaatattggtattggtctctctgtta |
32384197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 35377998 - 35377952
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35377998 |
attggtccatgcactttgtaaaaatattggtattggtccctctgtta |
35377952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 40005752 - 40005710
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40005752 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
40005710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 42208138 - 42208092
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42208138 |
attgatccctgcactttgtaaaaatattggtattggtccctctgtta |
42208092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 42496004 - 42496050
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42496004 |
attggtccctgcactttgtaaaaatattggtattgatccctctgtta |
42496050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 42598983 - 42599029
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42598983 |
attgatccctgcactttgtaaaaatattggtattggtccctctgtta |
42599029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 43979348 - 43979390
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43979348 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
43979390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 45226346 - 45226300
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45226346 |
attggtccctgcactttgtaaaaatattggtattggttcctctgtta |
45226300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 45311493 - 45311451
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45311493 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
45311451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 45311574 - 45311532
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45311574 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
45311532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 45848612 - 45848566
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45848612 |
attggtccctacactttgtaaaaatattggtattggtccctctgtta |
45848566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 46008963 - 46008917
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46008963 |
attggtccctgcactttgtaaaaatattggtattggttcctctgtta |
46008917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 51892971 - 51892925
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51892971 |
attggtccctacactttgtaaaaatattggtattggtccctctgtta |
51892925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 580 - 621
Target Start/End: Original strand, 321723 - 321764
Alignment:
| Q |
580 |
ttggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
321723 |
ttggtccctgcactttgtaaaaatattggtattggtccctct |
321764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 580 - 625
Target Start/End: Complemental strand, 39210594 - 39210549
Alignment:
| Q |
580 |
ttggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39210594 |
ttggtccctgcactttgtaaaaatatcggtattggtccctctgtta |
39210549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 1614095 - 1614135
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1614095 |
attggtccctgcactttgtaaaaatattggtattggtccct |
1614135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 11021463 - 11021503
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11021463 |
attggtccctgcactttgtaaaaatattggtattggtccct |
11021503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 13199231 - 13199191
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13199231 |
attggtccctgcactttgtaaaaatattggtattggtccct |
13199191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 15169200 - 15169160
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15169200 |
attggtccctgcactttgtaaaaatattggtattggtccct |
15169160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 16335314 - 16335274
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16335314 |
attggtccctgcactttgtaaaaatattggtattggtccct |
16335274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 32328129 - 32328181
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32328129 |
tttgacattggtccttgcactttgtaaaaatattggtattggtttctctgtta |
32328181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 41965295 - 41965335
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965295 |
attggtccctgcactttgtaaaaatattggtattggtccct |
41965335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 42496274 - 42496222
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42496274 |
tttggcattggtccttgtactttgtaaaaatattggtattggtccctctgtta |
42496222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 43561875 - 43561927
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
43561875 |
tttggcattggtccctgcattttgtaaaaatattggtattggtccctatgtta |
43561927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 43979430 - 43979470
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43979430 |
attggtccctgcactttgtaaaaatattggtattggtccct |
43979470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 49263942 - 49263994
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49263942 |
tttggcattgatccttgcactttgtaaaaatattggtattggtccctctgtta |
49263994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 49264131 - 49264091
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49264131 |
attggtccctgcactttgtaaaaatattggtattggtccct |
49264091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 51716278 - 51716318
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51716278 |
attggtccctgcactttgtaaaaatattggtattggtccct |
51716318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 52096885 - 52096833
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52096885 |
tttggcattgatccctgcactttgtaaaaatattggtattgatccctctgtta |
52096833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 580 - 619
Target Start/End: Complemental strand, 15169230 - 15169191
Alignment:
| Q |
580 |
ttggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15169230 |
ttggtccctgcactttgtaaaaatattggtattggtccct |
15169191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 23206003 - 23205961
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23206003 |
attggtccctgcactttgtaaaaatattggtattgatccctct |
23205961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 543 - 621
Target Start/End: Original strand, 28692962 - 28693040
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||| ||| |||| ||||||| ||||| ||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
28692962 |
gtgttattgctccctgcactttcatcatattttagcattggtccctacactttgtaaaaatattggtattggtctctct |
28693040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 35377735 - 35377777
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35377735 |
attggtccttgcactttgtaaaaatattggtattggtccctct |
35377777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 40005672 - 40005634
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40005672 |
attggtccctgcactttgtaaaaatattggtattggtcc |
40005634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 40147424 - 40147470
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
40147424 |
attggtccctgcactttgtaaaaatattggtattggtctctttgtta |
40147470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 46008621 - 46008663
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46008621 |
attggtccttgcactttgtaaaaatattggtattggtccctct |
46008663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 46008703 - 46008745
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46008703 |
attggtccttgcactttgtaaaaatattggtattggtccctct |
46008745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 47690630 - 47690584
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47690630 |
attggtccctacactttgtaaaaatattggtattgatccctctgtta |
47690584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 49264212 - 49264170
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49264212 |
attggtccctgtactttgtaaaaatattggtattggtccctct |
49264170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 51716196 - 51716242
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51716196 |
attgatccttgcactttgtaaaaatattggtattggtccctctgtta |
51716242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 621
Target Start/End: Original strand, 919245 - 919293
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||| |||| |
|
|
| T |
919245 |
tttgacattggtccttgtactttgtaaaaatattggtattggtctctct |
919293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 583 - 619
Target Start/End: Complemental strand, 919431 - 919395
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
919431 |
gtccctgcactttgtaaaaatattggtattggtccct |
919395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 1922807 - 1922759
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
1922807 |
tttggcattggtccttgcactttgtaaaaatattggcattggtccctct |
1922759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 621
Target Start/End: Original strand, 8444725 - 8444773
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
8444725 |
tttgaaattggtccctacactttgtaaaaatattggtattgatccctct |
8444773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 13086598 - 13086546
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13086598 |
tttggcattgatccatgcactttgtaaaaatattggtattggtccatctgtta |
13086546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 13199262 - 13199222
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13199262 |
attggtccctgcattttgtaaaaatattggtattggtccct |
13199222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 13199343 - 13199303
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13199343 |
attgatccctgcactttgtaaaaatattggtattggtccct |
13199303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 18436943 - 18436983
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18436943 |
attgatccctgcactttgtaaaaatattggtattggtccct |
18436983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 31317411 - 31317447
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31317411 |
attggtccctgcactttgtaaaaatattggtattggt |
31317447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 40147606 - 40147566
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40147606 |
attggtctctgcactttgtaaaaatattggtattggtccct |
40147566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 47690549 - 47690509
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47690549 |
attggtccctgcactttgtaaaaatattggtattagtccct |
47690509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 51716309 - 51716345
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51716309 |
attggtccctgcactttgtaaaaatattggtattggt |
51716345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 52096720 - 52096760
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52096720 |
attggtccctgcactttgtaaaattattggtattggtccct |
52096760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 53940483 - 53940523
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53940483 |
attggtccatgcactttgtaaaaatattggtattggtccct |
53940523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 53940564 - 53940604
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53940564 |
attggtccctacactttgtaaaaatattggtattggtccct |
53940604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 29526585 - 29526543
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29526585 |
attggtctctgcactttgtaaaaatattggtatcggtccctct |
29526543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 617
Target Start/End: Original strand, 52096640 - 52096678
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52096640 |
attggtccctacactttgtaaaaatattggtattggtcc |
52096678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 574 - 619
Target Start/End: Original strand, 321797 - 321842
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
321797 |
ttgatattggttcctgcactttgtaaaaatattgatattggtccct |
321842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 574 - 615
Target Start/End: Original strand, 321828 - 321869
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
321828 |
ttgatattggtccctgcactttgtaaaaatattgatattggt |
321869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 584 - 625
Target Start/End: Original strand, 5813854 - 5813895
Alignment:
| Q |
584 |
tccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
5813854 |
tccctgtactttgtaaaaatagtggtattggtccctctgtta |
5813895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 584 - 625
Target Start/End: Original strand, 10616531 - 10616572
Alignment:
| Q |
584 |
tccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10616531 |
tccctgtactttataaaaatattggtattggtccctctgtta |
10616572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 574 - 615
Target Start/End: Complemental strand, 44589258 - 44589217
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44589258 |
ttgatattggtccctgcactttgtaaaaatattgatattggt |
44589217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 322050 - 321998
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
322050 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
321998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 919404 - 919368
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
919404 |
attggtccctgcactttgtaaaaatattgatattggt |
919368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 1614126 - 1614162
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1614126 |
attggtccctgcactttgtaaaaatattgatattggt |
1614162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 1922650 - 1922686
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1922650 |
attggtccctgcactttgtaaaaatattgatattggt |
1922686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 13198982 - 13199034
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
13198982 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
13199034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 13199200 - 13199164
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13199200 |
attggtccctgcactttgtaaaaatattgatattggt |
13199164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 15168922 - 15168974
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
15168922 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
15168974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 15169169 - 15169133
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15169169 |
attggtccctgcactttgtaaaaatattgatattggt |
15169133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 16335283 - 16335247
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16335283 |
attggtccctgcactttgtaaaaatattgatattggt |
16335247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 18436974 - 18437010
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18436974 |
attggtccctgcactttgtaaaaatattgatattggt |
18437010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 23205708 - 23205760
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
23205708 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
23205760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 28693152 - 28693116
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28693152 |
attggtccttgcactttgtaaaaatattggtattggt |
28693116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 29526474 - 29526438
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29526474 |
attggtccctgcactttgtaaaaatattgatattggt |
29526438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 583 - 619
Target Start/End: Complemental strand, 29526501 - 29526465
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29526501 |
gtcccggcactttgtaaaaatattggtattggtccct |
29526465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 32328292 - 32328256
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32328292 |
attggtccctgcactttgtaaaaatattgatattggt |
32328256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 40147360 - 40147412
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
40147360 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
40147412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 41965214 - 41965250
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41965214 |
attggtccctgcactttgtaaaaatattgatattggt |
41965250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 41965326 - 41965362
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41965326 |
attggtccctgcactttgtaaaaatattgatattggt |
41965362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 42496333 - 42496281
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
42496333 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
42496281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 43562032 - 43561996
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43562032 |
attggtcccttcactttgtaaaaatattggtattggt |
43561996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 45311412 - 45311376
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45311412 |
attggtccctgcactttgtaaaaatattgatattggt |
45311376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 46009026 - 46008974
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
46009026 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
46008974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 49264100 - 49264064
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49264100 |
attggtccctgcactttgtaaaaatattgatattggt |
49264064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 51892672 - 51892724
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
51892672 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
51892724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 51892889 - 51892853
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51892889 |
attggtccctgcactttgtaaaaatattgatattggt |
51892853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 52096751 - 52096787
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52096751 |
attggtccctgcactttgtaaaactattggtattggt |
52096787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 53940595 - 53940631
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53940595 |
attggtccctgcactttgtaaaaatattgatattggt |
53940631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 544 - 595
Target Start/End: Original strand, 16335066 - 16335117
Alignment:
| Q |
544 |
tgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
16335066 |
tgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
16335117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 586 - 617
Target Start/End: Complemental strand, 44589328 - 44589297
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44589328 |
cctgcactttgtaaaaatattggtattggtcc |
44589297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 580 - 615
Target Start/End: Complemental strand, 45226265 - 45226230
Alignment:
| Q |
580 |
ttggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45226265 |
ttggtccctgcactttgtaaaaatattgatattggt |
45226230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 583 - 625
Target Start/End: Complemental strand, 919511 - 919469
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || |||||||| |
|
|
| T |
919511 |
gtccctccactttgtaaaaatattggtattgatctctctgtta |
919469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 1922568 - 1922610
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||| | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
1922568 |
attggttcatgcactttataaaaatattggtattggtccctct |
1922610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 28693232 - 28693191
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
28693232 |
attggtccttgcactt-gtaaaaatattggtattggtccctct |
28693191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 617
Target Start/End: Original strand, 35377816 - 35377854
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
35377816 |
attggtccctgtactttgtaaaaatattagtattggtcc |
35377854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 574 - 619
Target Start/End: Complemental strand, 5814038 - 5813993
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
5814038 |
ttgatattagtccctgcactttgtaaaaatattagtattagtccct |
5813993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 579 - 612
Target Start/End: Original strand, 45848459 - 45848492
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtatt |
612 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
45848459 |
attggtccctgcactttgtaaaaatattgatatt |
45848492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 1922866 - 1922814
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
1922866 |
gtgtcattggtccttgcattttcatcatattttggcattggtttctgcacttt |
1922814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 615
Target Start/End: Complemental strand, 5813998 - 5813966
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
5813998 |
gtccctgcactttgtaaaaatattgatattggt |
5813966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 615
Target Start/End: Original strand, 8444818 - 8444850
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
8444818 |
gtccctgcactttgtaaaaatattgatattggt |
8444850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 8445061 - 8445009
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||| ||| |||||| |||||||||||||||||| |
|
|
| T |
8445061 |
gtgtcattggtccctgcacttttatcagattttggcattggtccctgcacttt |
8445009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 11021494 - 11021530
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
11021494 |
attggtccctacactttgtaaaaatattgatattggt |
11021530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 31317442 - 31317478
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
31317442 |
attggttcctgcactttgtaaaaatattgatattggt |
31317478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 35378063 - 35378011
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||| ||||| |
|
|
| T |
35378063 |
gtgtcattggtccctgcaatttcatcagattttggcattggtccctgtacttt |
35378011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 39210660 - 39210608
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||||||| ||| |||||| |
|
|
| T |
39210660 |
gtgtcattggtccctgcactttcatcaaattttggcattggtacctacacttt |
39210608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 607
Target Start/End: Complemental strand, 40147575 - 40147547
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattg |
607 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40147575 |
attggtccctgcactttgtaaaaatattg |
40147547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 619
Target Start/End: Original strand, 42496089 - 42496125
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
42496089 |
gtccccgcactttttaaaaatattggtattggtccct |
42496125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 42496116 - 42496152
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
42496116 |
attggtccctgcactttgtaaaaattttgatattggt |
42496152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 43980179 - 43980127
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||||| |||||| |
|
|
| T |
43980179 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctacacttt |
43980127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 45311205 - 45311257
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| || | ||||||| |||||| |||||||||||||||||| |
|
|
| T |
45311205 |
gtgtcattggtccctgtactttcatcatattttggcattggtccctgcacttt |
45311257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 615
Target Start/End: Complemental strand, 47690514 - 47690482
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
47690514 |
gtccctgcactttgtaaaaatattgatattggt |
47690482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 49263883 - 49263935
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
49263883 |
gtgtcattggtccctgcactttcattagattttggcattggtccctgcacttt |
49263935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 3e-22; HSPs: 97)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 3199316 - 3199398
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3199316 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctacactttgtaaaaatattggtattagtccctctgtta |
3199398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 12396008 - 12395956
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12396008 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
12395956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 9566064 - 9566116
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9566064 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
9566116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 12395731 - 12395783
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12395731 |
tttgacattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
12395783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 17203933 - 17203985
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17203933 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
17203985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 33243237 - 33243289
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33243237 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
33243289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 33878024 - 33877972
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33878024 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
33877972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 10143552 - 10143506
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10143552 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
10143506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 6389980 - 6390029
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6389980 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctg |
6390029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 6535724 - 6535672
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6535724 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctttgtta |
6535672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 10143278 - 10143330
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10143278 |
tttggcattggtccctgcactttgtaaaaatattggtattggttcctctgtta |
10143330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 16120469 - 16120521
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16120469 |
tttggcattggtccctgcactttgtaaaaatattggtattggtctctctgtta |
16120521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 16409086 - 16409034
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16409086 |
tttggcattggtccctgcactttgtaaaaatattggtattggttcctctgtta |
16409034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 21905404 - 21905352
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21905404 |
tttggcattggtccctgcactttgtaaaaatattggtattgatccctctgtta |
21905352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 33706146 - 33706094
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33706146 |
tttggcattggtccctacactttgtaaaaatattggtattggtccctctgtta |
33706094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 583736 - 583778
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
583736 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
583778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 605779 - 605737
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
605779 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
605737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 6535483 - 6535529
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6535483 |
attggtccctgcaatttgtaaaaatattggtattggtccctctgtta |
6535529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 16408812 - 16408854
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16408812 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
16408854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 17204201 - 17204155
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17204201 |
attggtccctacactttgtaaaaatattggtattggtccctctgtta |
17204155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 21905101 - 21905143
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21905101 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
21905143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 33243510 - 33243468
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33243510 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
33243468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 33360521 - 33360567
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33360521 |
attggtccctgcactttgtaaaaatattggtattggtacctctgtta |
33360567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 33705875 - 33705921
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33705875 |
attgttccctgcactttgtaaaaatattggtattggtccctctgtta |
33705921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 2793102 - 2793151
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2793102 |
tttggcattggtccttgcactttgtaaaaatattggtattggtccctctg |
2793151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 573 - 622
Target Start/End: Original strand, 5997261 - 5997310
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctg |
622 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5997261 |
tttggcattggtccctgcactttgtaaaaatattggtattagtccctctg |
5997310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 583818 - 583858
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
583818 |
attggtccctgcactttgtaaaaatattggtattggtccct |
583858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 584009 - 583957
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
584009 |
tttggcattagtccctgcactttgtaaaaatattagtattggtccctctgtta |
583957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 605545 - 605597
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
605545 |
tttggcattggtccctgcactttgtataaatattgatattggtccctctgtta |
605597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 9566301 - 9566261
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9566301 |
attggtccctgcactttgtaaaaatattggtattggtccct |
9566261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 557 - 621
Target Start/End: Complemental strand, 14444963 - 14444899
Alignment:
| Q |
557 |
tgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| ||||||| |||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14444963 |
tgcactttcatcagattttggtattggtccctacactttgtaaaaatattggtattggtccctct |
14444899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 14630888 - 14630928
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14630888 |
attggtccctgcactttgtaaaaatattggtattggtccct |
14630928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 14631076 - 14631024
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14631076 |
tttggcattgatctctgcactttgtaaaaatattggtattggtccctctgtta |
14631024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 21905183 - 21905223
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21905183 |
attggtccctgcactttgtaaaaatattggtattggtccct |
21905223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 22695623 - 22695675
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22695623 |
tttggcattggtccttgcactttgtaaaaatattggtattggttcctctgtta |
22695675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 32219000 - 32219040
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32219000 |
attggtccctgcactttgtaaaaatattggtattggtccct |
32219040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 33243428 - 33243388
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33243428 |
attggtccctgcactttgtaaaaatattggtattggtccct |
33243388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 33360708 - 33360668
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33360708 |
attggtccctgcactttgtaaaaatattggtattggtccct |
33360668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 579 - 618
Target Start/End: Complemental strand, 32219185 - 32219146
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccc |
618 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32219185 |
attggtccctgcactttgtaaaaatattggtattggtccc |
32219146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 579 - 618
Target Start/End: Complemental strand, 33360677 - 33360638
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccc |
618 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33360677 |
attggtccctgcactttgtaaaaatattggtattggtccc |
33360638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 5997531 - 5997485
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
5997531 |
attggtccctgcactttgtaaaaatattggtattgatccctttgtta |
5997485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 6390252 - 6390206
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
6390252 |
attggtccctgcactttgtaaaaatattggtattgatccctttgtta |
6390206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 21904939 - 21904981
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21904939 |
attggtctctgcactttgtaaaaatattggtattggtccctct |
21904981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 22695925 - 22695883
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22695925 |
attggtccctgcactttgtaaaaatatttgtattggtccctct |
22695883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 32218917 - 32218959
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32218917 |
attggtccctgcactttgtaaaaatattggtactggtccctct |
32218959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 33360789 - 33360743
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33360789 |
attggtccctacactttgtaaaaatattggtattgatccctctgtta |
33360743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 582 - 619
Target Start/End: Original strand, 33705960 - 33705997
Alignment:
| Q |
582 |
ggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33705960 |
ggtccctgcactttgtaaaaatattggtattggtccct |
33705997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 5997450 - 5997410
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5997450 |
attggtccctgcactttgtaaaaatattggcattggtccct |
5997410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 6390171 - 6390131
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6390171 |
attggtccctgcactttgtaaaaaaattggtattggtccct |
6390131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 12395921 - 12395881
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12395921 |
attgatccctgcactttgtaaaaatattggtattggtccct |
12395881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 16408893 - 16408933
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16408893 |
attggtccctgcaccttgtaaaaatattggtattggtccct |
16408933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 21905214 - 21905254
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21905214 |
attggtccctgcactttgtaaaaatattgatattggtccct |
21905254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 22695564 - 22695616
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
22695564 |
gtgtcattggtccctgcactttcatcagattttgacattggtccctgcacttt |
22695616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 22695812 - 22695772
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22695812 |
attggtccctgcactttgtaaaaatattggtattgatccct |
22695772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 22695843 - 22695803
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22695843 |
attggtccctgcactttgtaaaattattggtattggtccct |
22695803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 33243178 - 33243230
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
33243178 |
gtgtcattggtccctgcattttcatcagattttggcattggtccctgcacttt |
33243230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 2793371 - 2793329
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
2793371 |
attggtccctacactttgtaaaaatattggtattgatccctct |
2793329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 21002842 - 21002884
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21002842 |
attgatccatgcactttgtaaaaatattggtattggtccctct |
21002884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 583 - 621
Target Start/End: Original strand, 21905023 - 21905061
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21905023 |
gtccttgcactttgtaaaaatattggtattggtccctct |
21905061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 574 - 615
Target Start/End: Original strand, 21905240 - 21905281
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21905240 |
ttgatattggtccctgcactttgtaaaaatattgatattggt |
21905281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 605698 - 605662
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
605698 |
attggtccctgcactttgtaaaaatattgatattggt |
605662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 2793043 - 2793095
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
2793043 |
gtgtcattggtccctgcactttcatcatattttggcattggtccctgcacttt |
2793095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 3199534 - 3199498
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3199534 |
attggtccctgcactttgtgaaaatattggtattggt |
3199498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 589 - 621
Target Start/End: Original strand, 5146901 - 5146933
Alignment:
| Q |
589 |
gcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5146901 |
gcactttgtaaaaatattggtattggtccctct |
5146933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 5997202 - 5997254
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||||||||||| ||||| |
|
|
| T |
5997202 |
gtgtcattggtccctgcactttcatcaaattttggcattggtccctgtacttt |
5997254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 6389921 - 6389973
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
6389921 |
gtgtcattggtccctgcactttcatcagattttgatattggtccctgcacttt |
6389973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 6535565 - 6535601
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6535565 |
attggtccctgcactttgtaaaaatattgatattggt |
6535601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 9566005 - 9566057
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
9566005 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
9566057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 9566270 - 9566234
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9566270 |
attggtccctgcactttgtaaaaatattgatattggt |
9566234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 14440566 - 14440606
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
14440566 |
attggtccttgcactttgtaaaattattggtattggtccct |
14440606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 14630919 - 14630955
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14630919 |
attggtccctgcactttgtaaaaatattgatattggt |
14630955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 17204121 - 17204081
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
17204121 |
attggtccctgcactttgtaaaattattggtatttgtccct |
17204081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 21905463 - 21905411
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
21905463 |
gtgtcattggtccctgcactttcatcagattttgccattggtccctgcacttt |
21905411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 32219031 - 32219067
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32219031 |
attggtccctgcactttgtaaaaatattgatattggt |
32219067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 32219250 - 32219198
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
32219250 |
gtgtcattggtccttgcactttcatcagattttggcattggtccctgcacttt |
32219198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 33243397 - 33243361
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33243397 |
attggtccctgcactttgtaaaaatattgatattggt |
33243361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 33360456 - 33360508
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
33360456 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
33360508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 33705988 - 33706024
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33705988 |
attggtccctgcactttgtaaaaatattgatattggt |
33706024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 583 - 625
Target Start/End: Complemental strand, 2182244 - 2182202
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
2182244 |
gtccctgcactttgtaaaaatattgacattggtccctttgtta |
2182202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 613
Target Start/End: Complemental strand, 2793261 - 2793227
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2793261 |
attggtccctgcactttgtaaaaatattgatattg |
2793227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 613
Target Start/End: Original strand, 16408924 - 16408958
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16408924 |
attggtccctgcactttgtaaaaatattgatattg |
16408958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 579 - 612
Target Start/End: Original strand, 583849 - 583882
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtatt |
612 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
583849 |
attggtccctgcactttgtaaaaatattgatatt |
583882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 586 - 619
Target Start/End: Complemental strand, 2793285 - 2793252
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
2793285 |
cctgtactttgtaaaaatattggtattggtccct |
2793252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 578 - 615
Target Start/End: Complemental strand, 5997420 - 5997383
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5997420 |
cattggtccctgcactttgtaaaaatatttatattggt |
5997383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 546 - 595
Target Start/End: Original strand, 10143223 - 10143272
Alignment:
| Q |
546 |
tcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
10143223 |
tcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
10143272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 579 - 612
Target Start/End: Original strand, 14440597 - 14440630
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtatt |
612 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
14440597 |
attggtccctgcactttgtaaaactattggtatt |
14440630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 605486 - 605538
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| || |||| |||||| |||||||||||||||||| |
|
|
| T |
605486 |
gtgtcattggtccttgcacttccatcagattttggcattggtccctgcacttt |
605538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 1827065 - 1827117
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
1827065 |
gtgtcattggtctctgcactttcatcagattttggcattggtccctgcacttt |
1827117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 607
Target Start/End: Complemental strand, 6390140 - 6390112
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattg |
607 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6390140 |
attggtccctgcactttgtaaaaatattg |
6390112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 591
Target Start/End: Complemental strand, 6535784 - 6535736
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgca |
591 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||| |
|
|
| T |
6535784 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgca |
6535736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 10143468 - 10143432
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
10143468 |
attggtccctacactttgtaaaaatattagtattggt |
10143432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 12395890 - 12395854
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
12395890 |
attggtccctacactttgtaaaaatattgatattggt |
12395854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 16409145 - 16409093
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||| | | |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
16409145 |
gtgtcattgattcctgcactttcatcagattttgacattggtccctgcacttt |
16409093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 17203874 - 17203926
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
17203874 |
gtgtcattggtccctgcactttcatcagattttggtattggtccctgcacttt |
17203926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 21002954 - 21002990
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
21002954 |
attggtctctgcactttgtaaaaatattgatattggt |
21002990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 21003176 - 21003124
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| |||| |||||||||||| |
|
|
| T |
21003176 |
gtgtcattggtccctgcactttcatcagattttgatattgatccctgcacttt |
21003124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 22695781 - 22695745
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
22695781 |
attgatccctgcactttgtaaaaatattgatattggt |
22695745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 3e-22; HSPs: 128)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 543 - 625
Target Start/End: Original strand, 52836638 - 52836720
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||| | ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52836638 |
gtgtcattggtccctgcactttcatcagattttaatattggtccctgcactttgtaaaaatgttggtattggtccctctgtta |
52836720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 11692503 - 11692451
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11692503 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
11692451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 21560866 - 21560918
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21560866 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
21560918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 27957528 - 27957580
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27957528 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
27957580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 29016040 - 29015988
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29016040 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
29015988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 34682349 - 34682401
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34682349 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
34682401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 38443385 - 38443437
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38443385 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
38443437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 44398221 - 44398169
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44398221 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
44398169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 47358218 - 47358270
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358218 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
47358270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 51437066 - 51437118
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51437066 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
51437118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 51754242 - 51754190
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51754242 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
51754190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 578 - 625
Target Start/End: Original strand, 35565114 - 35565161
Alignment:
| Q |
578 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35565114 |
cattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
35565161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 16222548 - 16222594
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16222548 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
16222594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 29015792 - 29015838
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29015792 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
29015838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 35565256 - 35565302
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35565256 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
35565302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 571 - 621
Target Start/End: Complemental strand, 54090185 - 54090135
Alignment:
| Q |
571 |
attttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54090185 |
attttggcattggtccctgcactttgtaaaaatattggtattggtccctct |
54090135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 556 - 625
Target Start/End: Original strand, 26920629 - 26920698
Alignment:
| Q |
556 |
atgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| ||||||| ||||||| | ||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26920629 |
atgcactttcatcaaattttggcgttggtccatgcactttgtaaaaatattggtattggttcctctgtta |
26920698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 572 - 625
Target Start/End: Original strand, 51760857 - 51760910
Alignment:
| Q |
572 |
ttttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
51760857 |
ttttgacattggtccctgcactttgtaaaaatattggtattgatccatctgtta |
51760910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 572 - 625
Target Start/End: Complemental strand, 55328785 - 55328732
Alignment:
| Q |
572 |
ttttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55328785 |
ttttggcattggtctctgcactttgtaaaaatattggtattggtccctctgtta |
55328732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 3017515 - 3017463
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3017515 |
tttggcattggttcctgcactttgtaaaaatattggtattggtccctctgtta |
3017463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 19987903 - 19987955
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19987903 |
tttgaaattggtccctgcactttgtaaaaatattgatattggtccctctgtta |
19987955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 543 - 615
Target Start/End: Complemental strand, 31705503 - 31705431
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
31705503 |
gtgtcattggtccctgcactttcatcagattttgacattggttcctgtactttataaaaatattggtattggt |
31705431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 40036989 - 40036937
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40036989 |
tttggcattggtccctacactttgtaaaaatattggtattggtccctctgtta |
40036937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 40791152 - 40791100
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40791152 |
tttggcattggtccctgcactttataaaaatattggtattggtccctctgtta |
40791100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 47982430 - 47982482
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47982430 |
tttggcattggtccctacactttgtaaaaatattggtattggtccctctgtta |
47982482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 47991717 - 47991769
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47991717 |
tttggcattggtccctacactttgtaaaaatattggtattggtccctctgtta |
47991769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 48001004 - 48001056
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48001004 |
tttggcattggtccctacactttgtaaaaatattggtattggtccctctgtta |
48001056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 48010291 - 48010343
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48010291 |
tttggcattggtccctacactttgtaaaaatattggtattggtccctctgtta |
48010343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 49665397 - 49665449
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49665397 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccatctgtta |
49665449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 54803349 - 54803297
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54803349 |
tttggcattggtccctgcactttgtaaaaatattggtattggtctctctgtta |
54803297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 11692229 - 11692271
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11692229 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
11692271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 21441042 - 21441084
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21441042 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
21441084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 21561138 - 21561096
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21561138 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
21561096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 543 - 613
Target Start/End: Complemental strand, 23461235 - 23461165
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
||||||||||||| | || ||||||| |||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23461235 |
gtgtcattggtccctacactttcatcagattttggcattggtccctgcacttagtaaaaatattggtattg |
23461165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 26050562 - 26050608
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26050562 |
attggtcccttcactttgtaaaaatattggtattggtccctctgtta |
26050608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 29352479 - 29352525
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29352479 |
attggtccttgcactttgtaaaaatattggtattggtccctctgtta |
29352525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 40790882 - 40790924
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40790882 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
40790924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 47358495 - 47358453
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358495 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
47358453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 49665634 - 49665592
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49665634 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
49665592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 54803108 - 54803154
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803108 |
attggtccatgcactttgtaaaaatattggtattggtccctctgtta |
54803154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 54089908 - 54089961
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgt-aaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54089908 |
tttggcattggtccctgcactttgttaaaaatattggtattggtccctctgtta |
54089961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 11692311 - 11692351
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11692311 |
attggtccctgcactttgtaaaaatattggtattggtccct |
11692351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 11692562 - 11692510
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
11692562 |
gtgtcattggtccctgcattttcatcaaattttgacattggttcctgcacttt |
11692510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 16732073 - 16732113
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16732073 |
attggtccctgcactttgtaaaaatattggtattggtccct |
16732113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 16732263 - 16732211
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
16732263 |
tttggcattggtccctgcactttataaaaatattggtattgatccctctgtta |
16732211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 21441282 - 21441230
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21441282 |
tttggcattggtccctacactttgtaaaaatattggtatttgtccctctgtta |
21441230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 23461015 - 23461055
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23461015 |
attggtccctgcactttgtaaaaatattggtattggtccct |
23461055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 31705277 - 31705317
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31705277 |
attggtccctgcactttgtaaaaatattggtattggtccct |
31705317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 40037048 - 40036996
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
40037048 |
gtgtcattggtccctgcattttcatcaaattttggcattggtccctgcacttt |
40036996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 44397999 - 44398039
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44397999 |
attggtccctgcactttgtaaaaatattggtattggtccct |
44398039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 47982673 - 47982625
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47982673 |
tttgaaattggtccatgcactttgtaaaaatattggtattggtccctct |
47982625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 47991960 - 47991912
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47991960 |
tttgaaattggtccatgcactttgtaaaaatattggtattggtccctct |
47991912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 48001247 - 48001199
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48001247 |
tttgaaattggtccatgcactttgtaaaaatattggtattggtccctct |
48001199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 48010534 - 48010486
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48010534 |
tttgaaattggtccatgcactttgtaaaaatattggtattggtccctct |
48010486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 51761113 - 51761065
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51761113 |
tttggcatcggtccctgcactttgtaaaaatattggtattggtccctct |
51761065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 52836900 - 52836848
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52836900 |
tttgaaattggtctctgcactttgtaaaaatattggtattggtccatctgtta |
52836848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 573 - 616
Target Start/End: Original strand, 3017320 - 3017363
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3017320 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtc |
3017363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 27957801 - 27957759
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27957801 |
attggtccatgcactttgtaaaaatattggtattggtccctct |
27957759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 33092109 - 33092151
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33092109 |
attggtccttgcactttgtaaaaatattggtattggtccctct |
33092151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 38443624 - 38443586
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38443624 |
attggtccctgcactttgtaaaaatattggtattggtcc |
38443586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 40036720 - 40036762
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40036720 |
attggtccctgcactttataaaaatattggtattggtccctct |
40036762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 573 - 619
Target Start/End: Complemental strand, 40393727 - 40393681
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40393727 |
tttgaaattggtccatgcactttgtaaaaatattggtattggtccct |
40393681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 51753969 - 51754011
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51753969 |
attggcccctgcactttgtaaaaatattggtattggtccctct |
51754011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 574 - 619
Target Start/End: Original strand, 16222627 - 16222672
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16222627 |
ttgatattagtccctgcactttgtaaaaatattggtattggtccct |
16222672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 574 - 619
Target Start/End: Original strand, 29015869 - 29015914
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29015869 |
ttgatattggtccctgcactttgtaaaaatattggtattgatccct |
29015914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 3017576 - 3017524
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
3017576 |
gtgtcattggtccctgcattttcatcagattttggcattggtccctgcacttt |
3017524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 26920924 - 26920872
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
26920924 |
tttggcattggtccctgcattttataaaactattggtattggtccctctgtta |
26920872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 34682538 - 34682498
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34682538 |
attgctccctgcactttgtaaaaatattggtattggtccct |
34682498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 40036829 - 40036865
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40036829 |
attggtccctgcactttgtaaaaatattggtattggt |
40036865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 617
Target Start/End: Original strand, 40393528 - 40393572
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40393528 |
tttggcattggtctctgcactttgtaaaaatattggtattggtcc |
40393572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 40790962 - 40791002
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40790962 |
attggtccctgcactttataaaaatattggtattggtccct |
40791002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 44398030 - 44398070
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44398030 |
attggtccctgcactttgtaaaaatattggtattagtccct |
44398070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 586 - 621
Target Start/End: Complemental strand, 34682614 - 34682579
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34682614 |
cctgcactttgtaaaaatattggtattggtccctct |
34682579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 16731992 - 16732034
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16731992 |
attggtctctgcactttgtaaaaatattggtattgatccctct |
16732034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 573 - 615
Target Start/End: Complemental strand, 35565416 - 35565374
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35565416 |
tttgaaattggtccctgcactttgtaaaaatattgatattggt |
35565374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 44638487 - 44638529
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
44638487 |
attggtccatgcactttgtaaaaatattggtattggtctctct |
44638529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 51761026 - 51760988
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51761026 |
attggtccctgcactttataaaaatattggtattggtcc |
51760988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 617
Target Start/End: Original strand, 55328593 - 55328631
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55328593 |
attggtctctgcactttgtaaaaatattggtattggtcc |
55328631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 579 - 616
Target Start/End: Complemental strand, 29352661 - 29352624
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29352661 |
attggtctctgcactttgtaaaaatattggtattggtc |
29352624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 579 - 616
Target Start/End: Original strand, 33092192 - 33092229
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33092192 |
attggtccccgcactttgtaaaaatattggtattggtc |
33092229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 47358414 - 47358373
Alignment:
| Q |
579 |
attggtccctgcactttgta-aaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47358414 |
attggtccctgcactttgtaaaaaatattggtattggtccct |
47358373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 586 - 623
Target Start/End: Complemental strand, 51437300 - 51437263
Alignment:
| Q |
586 |
cctgcactttgtaaaaatattggtattggtccctctgt |
623 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51437300 |
cctgcactttgtaaaaatattggtattagtccctctgt |
51437263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 11692342 - 11692378
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11692342 |
attggtccctgcactttgtaaaaatattgatattggt |
11692378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 581 - 625
Target Start/End: Complemental strand, 16222814 - 16222770
Alignment:
| Q |
581 |
tggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||| || |||||| |||||||||||||||||||||||||||| |
|
|
| T |
16222814 |
tggtccatgtactttgaaaaaatattggtattggtccctctgtta |
16222770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 16732104 - 16732140
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16732104 |
attggtccctgcactttgtaaaaatattgatattggt |
16732140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 583 - 619
Target Start/End: Original strand, 19987997 - 19988033
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19987997 |
gtccctgcactttgtaaaaatattagtattggtccct |
19988033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 23461046 - 23461082
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23461046 |
attggtccctgcactttgtaaaaatattgatattggt |
23461082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 26920763 - 26920799
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26920763 |
attggtccttgcactttgtaaaaatattggtattggt |
26920799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 27957689 - 27957653
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27957689 |
attggtccctgcactttgtaaaaatattgatattggt |
27957653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 27957720 - 27957680
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
27957720 |
attggtccctgcactttgttaaactattggtattggtccct |
27957680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 31705308 - 31705344
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31705308 |
attggtccctgcactttgtaaaaatattgatattggt |
31705344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 34682507 - 34682471
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34682507 |
attggtccctgcactttgtaaaaatattgatattggt |
34682471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 38443543 - 38443507
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38443543 |
attggtccctgcactttgtaaaaatattgatattggt |
38443507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 40036798 - 40036838
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
40036798 |
attggttcctgcactttgtaaaaatattagtattggtccct |
40036838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 40393690 - 40393654
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40393690 |
attggtccctgcactttgtaaaaatattgatattggt |
40393654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 40790993 - 40791029
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40790993 |
attggtccctgcactttgtaaaaatattgatattggt |
40791029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 47358382 - 47358346
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47358382 |
attggtccctgcactttgtaaaaatattgatattggt |
47358346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 49665552 - 49665516
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49665552 |
attggtccctgcactttgtaaaaatattgatattggt |
49665516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 51437226 - 51437190
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51437226 |
attggtccctgcactttgtaaaaatattgatattggt |
51437190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 51754051 - 51754091
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
51754051 |
attggtctctgcattttgtaaaaatattggtattggtccct |
51754091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 51754082 - 51754118
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51754082 |
attggtccctgcactttgtaaaaatattgatattggt |
51754118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 51754301 - 51754249
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
51754301 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
51754249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 55328514 - 55328554
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
55328514 |
attggtccctgcattttgtaaaaatattcgtattggtccct |
55328554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 579 - 614
Target Start/End: Original strand, 16222663 - 16222698
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattgg |
614 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16222663 |
attggtccctgcactttgtaaaaatattgatattgg |
16222698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 573 - 624
Target Start/End: Complemental strand, 19988182 - 19988131
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtt |
624 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||||||||||| | |||||| |
|
|
| T |
19988182 |
tttggcattggtccatgtactttgtaaaaatattggtattggttcgtctgtt |
19988131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 579 - 617
Target Start/End: Original strand, 26920731 - 26920770
Alignment:
| Q |
579 |
attggtccctgca-ctttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26920731 |
attggtccctgcaactttgtaaaaatattggtattggtcc |
26920770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 613
Target Start/End: Original strand, 19988024 - 19988058
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19988024 |
attggtccctgcactttgtaaaaatattgatattg |
19988058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 557 - 595
Target Start/End: Original strand, 40393482 - 40393520
Alignment:
| Q |
557 |
tgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
40393482 |
tgcactttcatcaaattttgacattggtccctgcacttt |
40393520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 609
Target Start/End: Complemental strand, 54090094 - 54090064
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggt |
609 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54090094 |
attggtccctgcactttgtaaaaatattggt |
54090064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 579 - 616
Target Start/End: Complemental strand, 21561056 - 21561019
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtc |
616 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21561056 |
attggtccctgcactttgtaaaaattatggtattggtc |
21561019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 574 - 615
Target Start/End: Complemental strand, 52836830 - 52836789
Alignment:
| Q |
574 |
ttgacattggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
52836830 |
ttgatattgatccctgcactttgtaaaaatattgatattggt |
52836789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 3017357 - 3017393
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
3017357 |
attggtcactgcactttgtaaaaatattgatattggt |
3017393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 16222881 - 16222829
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| | || ||||||| |||||| |||||||||||||||||| |
|
|
| T |
16222881 |
gtgtcattggtccctacactttcatcagattttggcattggtccctgcacttt |
16222829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 16732322 - 16732270
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| ||| ||| |||||||| ||||||||| |
|
|
| T |
16732322 |
gtgtcattggtccttgcactttcatcaaatgttggcattggtctctgcacttt |
16732270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 19988272 - 19988220
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| |||| || |||||| |||||||||||||||||| |
|
|
| T |
19988272 |
gtgtcattggtccctgcactttcttcagattttggcattggtccctgcacttt |
19988220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 607
Target Start/End: Original strand, 21441123 - 21441151
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattg |
607 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21441123 |
attggtccctgcactttgtaaaaatattg |
21441151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 21441342 - 21441290
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||| |||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
21441342 |
gtgtcactggtccctgcactttcatcagattttggcattggtccctgcacttt |
21441290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 21561025 - 21560989
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
21561025 |
attggtctctgcactttgtaaaaatattgatattggt |
21560989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 29352413 - 29352465
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
29352413 |
gtgtcattggtctctgcactttcatcagattttggcattggtccctgcacttt |
29352465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 29352630 - 29352594
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
29352630 |
attggtctctgcactttgtaaaaatattgctattggt |
29352594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 33092223 - 33092259
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
33092223 |
attggtcactgcactttgtaaaaatattgatattggt |
33092259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 34682288 - 34682340
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
34682288 |
gtgtcattggtccctgcactttcatcagattttggtattggtccctgcacttt |
34682340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 583 - 615
Target Start/End: Original strand, 44398065 - 44398097
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
44398065 |
gtccctgcactttgtaaaaatattgatattggt |
44398097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 591
Target Start/End: Original strand, 47358159 - 47358207
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgca |
591 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||| |
|
|
| T |
47358159 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgca |
47358207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 51760995 - 51760959
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
51760995 |
attggtccatgcactttgtaaaaatattgatattggt |
51760959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 51761172 - 51761120
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
51761172 |
gtgtcattggtccctgcactttcatcatattttggcattagtccctgcacttt |
51761120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 54803189 - 54803225
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
54803189 |
attggtccatgcactttgtaaaaatattgatattggt |
54803225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 55328624 - 55328660
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
55328624 |
attggtccatgcactttgtaaaaatattgatattggt |
55328660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 53; Significance: 4e-21; HSPs: 4)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 35684 - 35632
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35684 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
35632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 617
Target Start/End: Original strand, 35409 - 35447
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35409 |
attggtccctgcactttgtaaaaatattagtattggtcc |
35447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 617
Target Start/End: Original strand, 35491 - 35529
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
35491 |
attggtctctggactttgtaaaaatattggtattggtcc |
35529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #4
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 35743 - 35691
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| ||||| |||||||||||| |
|
|
| T |
35743 |
gtgtcattggtccctgcactttcatcagattttggcattgatccctgcacttt |
35691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 50; Significance: 3e-19; HSPs: 3)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 572 - 625
Target Start/End: Original strand, 49783 - 49836
Alignment:
| Q |
572 |
ttttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49783 |
ttttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
49836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Complemental strand, 50055 - 50009
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50055 |
attggtccatacactttgtaaaaatattggtattggtccctctgtta |
50009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 579 - 617
Target Start/End: Complemental strand, 49974 - 49936
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtcc |
617 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
49974 |
attggtccctgcactttgtaaaattattggtattagtcc |
49936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302 (Bit Score: 49; Significance: 1e-18; HSPs: 5)
Name: scaffold0302
Description:
Target: scaffold0302; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 14193 - 14245
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14193 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
14245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 621
Target Start/End: Complemental strand, 14470 - 14422
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14470 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtccctct |
14422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 619
Target Start/End: Complemental strand, 14383 - 14343
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14383 |
attggtccctgcactttgtaaaagtattggtattggtccct |
14343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 543 - 595
Target Start/End: Original strand, 14134 - 14186
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
14134 |
gtgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
14186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 14352 - 14316
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14352 |
attggtccctgcactttgtaaaaatattgatattggt |
14316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 49; Significance: 1e-18; HSPs: 4)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 58764 - 58712
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
58764 |
tttggcattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
58712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 58521 - 58563
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
58521 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
58563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 543 - 595
Target Start/End: Complemental strand, 58823 - 58771
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
58823 |
gtgtcattggtccatgcactttcatcagattttggcattggtccctgcacttt |
58771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 58602 - 58638
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
58602 |
attggtccctgcactttgtaaaaatattagtattggt |
58638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0651 (Bit Score: 47; Significance: 2e-17; HSPs: 4)
Name: scaffold0651
Description:
Target: scaffold0651; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 6103 - 6149
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6103 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
6149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0651; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 6367 - 6325
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6367 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
6325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0651; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 6287 - 6251
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6287 |
attggtccctgcactttgtaaaaatattggtattggt |
6251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0651; HSP #4
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 6256 - 6220
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
6256 |
attggttcctgcactttgtaaaaatattgatattggt |
6220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0825 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0825
Description:
Target: scaffold0825; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 621
Target Start/End: Original strand, 1242 - 1290
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1242 |
tttgaaattggtccctgcactttgtaaaaatattggtattggtccctct |
1290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0825; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 579 - 618
Target Start/End: Original strand, 1330 - 1369
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccc |
618 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330 |
attggtccctgcactttgtaaaaatattggtattggtccc |
1369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0185 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0185
Description:
Target: scaffold0185; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Original strand, 8131 - 8183
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8131 |
tttggcattggtccttgcactttgtaaaaatattggtattggtccctctgtta |
8183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0185; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Complemental strand, 8292 - 8256
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8292 |
attggtccctgcactttgtaaaaatattgatattggt |
8256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079 (Bit Score: 45; Significance: 2e-16; HSPs: 5)
Name: scaffold0079
Description:
Target: scaffold0079; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 57736 - 57684
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
57736 |
tttggcattgatccctgcactttgtaaaaatattggtattggtccctctgtta |
57684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 57463 - 57505
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
57463 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
57505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 579 - 619
Target Start/End: Original strand, 57546 - 57586
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
57546 |
attggtccctgcactttgtaaaaatattggtattggtccct |
57586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 57577 - 57613
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
57577 |
attggtccctgcactttgtaaaaatattgatattggt |
57613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 544 - 595
Target Start/End: Complemental strand, 57794 - 57743
Alignment:
| Q |
544 |
tgtcattggtccatgcattttcatcgaattttgacattggtccctgcacttt |
595 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
57794 |
tgtcattggtccctgcactttcatcagattttggcattggtccctgcacttt |
57743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 45; Significance: 2e-16; HSPs: 4)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 573 - 625
Target Start/End: Complemental strand, 17181 - 17129
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
17181 |
tttgacattggtccctgcactttgtaaaaatattggtattagtccatctgtta |
17129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 16910 - 16952
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910 |
attgatccctgcactttgtaaaaatattggtattggtccctct |
16952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 583 - 619
Target Start/End: Original strand, 16995 - 17031
Alignment:
| Q |
583 |
gtccctgcactttgtaaaaatattggtattggtccct |
619 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16995 |
gtccctgcactttgtaaaaatattggtattggtccct |
17031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #4
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 17022 - 17058
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
17022 |
attggtccctacactttgtaaaaatattgatattggt |
17058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 3)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 543 - 625
Target Start/End: Complemental strand, 1611 - 1529
Alignment:
| Q |
543 |
gtgtcattggtccatgcattttcatcgaattttgacattggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||| |||||||| |||| ||||||| |||||| ||||| ||||||||||||||||||||| || ||||||| ||||||||| |
|
|
| T |
1611 |
gtgtaattggtccttgcactttcatcagattttggcattgatccctgcactttgtaaaaataatgttattggttcctctgtta |
1529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 579 - 613
Target Start/End: Original strand, 1340 - 1374
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattg |
613 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1340 |
attggtccctgcactttgtaaaaatattggtattg |
1374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 1420 - 1456
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1420 |
attggtccctgcactttgtaaaaatattgatattggt |
1456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0229 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 1)
Name: scaffold0229
Description:
Target: scaffold0229; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 579 - 621
Target Start/End: Complemental strand, 24375 - 24333
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24375 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
24333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0838 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0838
Description:
Target: scaffold0838; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 5342 - 5388
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5342 |
attggtccctacactttgtaaaaatattagtattggtccctctgtta |
5388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0832 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0832
Description:
Target: scaffold0832; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 625
Target Start/End: Original strand, 5373 - 5419
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctctgtta |
625 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5373 |
attggtccctacactttgtaaaaatattagtattggtccctctgtta |
5419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0385 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 2)
Name: scaffold0385
Description:
Target: scaffold0385; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 579 - 621
Target Start/End: Original strand, 13041 - 13083
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13041 |
attggtccctgcagtttgtaaaaatattggtattggtccctct |
13083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0385; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 579 - 615
Target Start/End: Original strand, 13122 - 13158
Alignment:
| Q |
579 |
attggtccctgcactttgtaaaaatattggtattggt |
615 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13122 |
attggtccctgcactttgtaaaaatattggtattggt |
13158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0421 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0421
Description:
Target: scaffold0421; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 573 - 621
Target Start/End: Original strand, 3017 - 3065
Alignment:
| Q |
573 |
tttgacattggtccctgcactttgtaaaaatattggtattggtccctct |
621 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
3017 |
tttggcattggtccttgcactttgtaaaaatattggtattgatccctct |
3065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University