View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5616_high_25 (Length: 248)
Name: NF5616_high_25
Description: NF5616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5616_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 34465854 - 34465616
Alignment:
| Q |
1 |
agcggagagcagtttcttagctctttgattggacggaactaccaaatcatcaaatgatttgtcttaacattaataacagaattgcattcannnnnnncat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34465854 |
agcggagagcagtttcttagctctttgattggacggaactaccaaatcatcaaatgatttgtcttaacattaataacagaattgcattcatttttttcat |
34465755 |
T |
 |
| Q |
101 |
aacattgaggttgccagatttatactcaggtgtggcactaagttgtttgaattatttgggagttctagaatggtatattttctctagcttgatccttaaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465754 |
aacattggggttgccagatttatactcaggtgtggcactaagttgtttgaattatttgggagttctagaatggtatattttctctagcttgatccttaaa |
34465655 |
T |
 |
| Q |
201 |
tgatgtattgttggtgatggagagtacttccttgatttt |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34465654 |
tgatgtattgttggtgatggagaatacttccttgatttt |
34465616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 230
Target Start/End: Complemental strand, 27807489 - 27807440
Alignment:
| Q |
181 |
tctctagcttgatccttaaatgatgtattgttggtgatggagagtacttc |
230 |
Q |
| |
|
||||||||||||||||||| | ||| | |||||||||||||||||||||| |
|
|
| T |
27807489 |
tctctagcttgatccttaattaatgaactgttggtgatggagagtacttc |
27807440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University