View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5616_low_23 (Length: 257)
Name: NF5616_low_23
Description: NF5616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5616_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 237
Target Start/End: Original strand, 38752957 - 38753184
Alignment:
| Q |
10 |
catcatcatcaacaacctttcatggatattagcatggaaggattctcacatgcaactatggtgacaacaagtcccaccatgtcatcaaatggtcacttga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38752957 |
catcatcatcaacaacctttcatggatattagcatggaaggattctcacatgcaactatggttacaacaagtcccaccatgtcatcaaatggtcacttga |
38753056 |
T |
 |
| Q |
110 |
ccccaaagaacaacacattcaaaccaatcagaaaaagatctagagcttcaaagaaaactccaattactcttctcaatgccaatagcacaaatttcagggc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38753057 |
ccccaaagaacaacacattcaaaccaatcagaaaaagatctagagcttcaaagaaaactccaatcactcttctcaatgccaatagcacaaatttcagggc |
38753156 |
T |
 |
| Q |
210 |
tttggttcaacaattcacaggttgtcct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38753157 |
tttggttcaacaattcacaggttgtcct |
38753184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 184 - 237
Target Start/End: Complemental strand, 7006139 - 7006086
Alignment:
| Q |
184 |
aatgccaatagcacaaatttcagggctttggttcaacaattcacaggttgtcct |
237 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| ||| ||||||||| |||||| |
|
|
| T |
7006139 |
aatgccaatacaacaaatttcagagctttggtttaactattcacaggctgtcct |
7006086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University