View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5616_low_26 (Length: 246)
Name: NF5616_low_26
Description: NF5616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5616_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 34465958 - 34466189
Alignment:
| Q |
1 |
aggcgaacaatagttagttttcgttggaattattttccaaaccaacgaaaatgacattttggacgttgatatgctgaatactctatttgtttaagaattt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465958 |
aggcgaacaatagttagttttcattggaattattttccaaaccaacgaaaatgacattttggacgttgatatgctgaatactctatttgtttaagaattt |
34466057 |
T |
 |
| Q |
101 |
agattatgctctaagcaaacgccacaattctcacatggttgtgggtggta--nnnnnnnncctcagtgccaactgactttgattacaggtggtgtctagg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466058 |
agattatgctctaagcaaacgccacaattctcacatggttgtgggtggtattttttttttcctcagtgccaactgactttgattacaggtggtgtctagg |
34466157 |
T |
 |
| Q |
199 |
acagcatcacatttgcatatattggttatatc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34466158 |
acagcatcacatttgcatatattggttatatc |
34466189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 62 - 144
Target Start/End: Original strand, 34464320 - 34464402
Alignment:
| Q |
62 |
gacgttgatatgctgaatactctatttgtttaagaatttagattatgctctaagcaaacgccacaattctcacatggttgtgg |
144 |
Q |
| |
|
|||||||| ||| |||||| ||||||| || ||||||||||| || || |||||||| |||| |||||||||||||||||| |
|
|
| T |
34464320 |
gacgttgagatgttgaataacctatttggtttggaatttagattttgttccaagcaaacaccactattctcacatggttgtgg |
34464402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University