View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5617-Insertion-1 (Length: 399)
Name: NF5617-Insertion-1
Description: NF5617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5617-Insertion-1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 16 - 380
Target Start/End: Complemental strand, 2637441 - 2637077
Alignment:
| Q |
16 |
attcctcctttatccttcttttgcctcttcagcttttctctttttgcataccaatatcttgtcttcttccttttaccttacaaatgtaaatgtgatgata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2637441 |
attcctcctttatccttcttttgcctcttcagcttttctccttttggataccaatatcttgtcttcttccttttaccttacaaatgtaaatgtgatgata |
2637342 |
T |
 |
| Q |
116 |
atggattgtctattgcaccatgcaaggtttttgtaaatatataattaattcatgtcatcaattagtttacagtccatgcccagttgtactcataactgca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||| || |
|
|
| T |
2637341 |
atggattgtctattgcaccatgcaaggtttttgtaaatatataattaattcatgtcatcaattagtttacactccatgctcagtcgtactcataactaca |
2637242 |
T |
 |
| Q |
216 |
ctctaccggtagagtcttttttctatcggccgaagagtggacctccaaatgtaggtgtccagaagtcgacaggagtctcattagtcatcggaaatgtgct |
315 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2637241 |
ctctactggtagaatcttttttctatcggccgaagagtggacctccaaaagtaggtgtccagaagtcgacaggagtctcattagtcatcggaaatgtgct |
2637142 |
T |
 |
| Q |
316 |
tgaaatcggcaccaaacaaagtccttggcttcctaagtcttgttttttcccttctgactcattca |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
2637141 |
tgaaatcggcaccaaacaaagtccttggcttcttaaatcttgttttttcccttctgactcattca |
2637077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University