View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5617_high_8 (Length: 269)

Name: NF5617_high_8
Description: NF5617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5617_high_8
NF5617_high_8
[»] chr3 (1 HSPs)
chr3 (3-150)||(52860005-52860152)


Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 3 - 150
Target Start/End: Original strand, 52860005 - 52860152
Alignment:
3 aacataaaataagaaagagagagggaatcacatcacacattgaaatacaacaacaaatgactcttgttgtggggaacagcagcgtttgcagtgaccaaag 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||||||||||||||||    
52860005 aacataaaataagaaagagagagggaatcacatcacacattgaaatacagcaacagctgactcttgttgtggggaacagcagcgtttgcagtgaccaaag 52860104  T
103 tagcagagtagagcgcaaacgctcctgtgaactgaataactagctagt 150  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||    
52860105 tagcagattagagcgcaaacgctcctgtgaactgaataactagctagt 52860152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University