View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5617_low_10 (Length: 249)
Name: NF5617_low_10
Description: NF5617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5617_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 23 - 249
Target Start/End: Original strand, 9802655 - 9802881
Alignment:
| Q |
23 |
ggagtttgaaccatgagcaacaccaaaaaagagaccaagatccgtacaagaattgaaccaataaatcctactcctatttcattttgtagggttcatagta |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9802655 |
ggaggttgaaccatgagcaacaccaaaaaagagaccaagatccgtacaagaattgaaccaataaatcccactcctatttcattttgtagggttcatagta |
9802754 |
T |
 |
| Q |
123 |
gatgactggtagatagattatcgtactaggaccaaaccaacaaaagcataataatcgtactattacctctcaacttccagcaatttaaccatggttaacc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
9802755 |
gatgactggtagatagattatcgtactaggaccaaaccaacaaaagcataataatcgtactattacctctcaacttccaacaatttaaccctggttaacc |
9802854 |
T |
 |
| Q |
223 |
tttttaaccctagttaacactaaaaac |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9802855 |
tttttaaccctagttaacactaaaaac |
9802881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University