View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5617_low_5 (Length: 397)
Name: NF5617_low_5
Description: NF5617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5617_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 2e-74; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 207 - 352
Target Start/End: Complemental strand, 18151467 - 18151322
Alignment:
| Q |
207 |
ctcaattcaactctcatctctattatgatattcaggatgtctatcttatatgtttataatagacattataatctatcgagttcgaccttagaaagtttta |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18151467 |
ctcaattcaactctcatctctattatgatattcaggatgtctatcttatatgtttctaatagacattataatctatcgagttcgaccttagaaagtttta |
18151368 |
T |
|
| Q |
307 |
caacgaaaatatgagaactatctatcactatcatggtggttgcaat |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18151367 |
caacgaaaatatgagaactatctatcactatcatggtggttgcaat |
18151322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 16 - 165
Target Start/End: Complemental strand, 18151658 - 18151509
Alignment:
| Q |
16 |
atgtaactgttgaattctttggtgacgatctcaatggagtcggttatagtgatcatgctgttgtgaaaaaatatgatctacgtgctaactttacttttct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18151658 |
atgtaactgttgaattctttggtgacgatctcaatgcagtcggttatagtgatccggctgttgtgaaaaaatatgatctatgtgctaactttacttttct |
18151559 |
T |
|
| Q |
116 |
tataggcttctgatccatgaatttgaatttctagcacacctttggctaca |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18151558 |
tataggcttctgatccatgaatttgaatttctagcacacctttggctaca |
18151509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 284 - 352
Target Start/End: Complemental strand, 18162695 - 18162627
Alignment:
| Q |
284 |
gagttcgaccttagaaagttttacaacgaaaatatgagaactatctatcactatcatggtggttgcaat |
352 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
18162695 |
gagtttgaccttagaaagttttgcaagaaaaatgtaagaactatctatcactatcatggtggttgcaat |
18162627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 263 - 344
Target Start/End: Complemental strand, 18159144 - 18159063
Alignment:
| Q |
263 |
taatagacattataatctatcgagttcgaccttagaaagttttacaacgaaaatatgagaactatctatcactatcatggtg |
344 |
Q |
| |
|
||||||||||| | ||||||| | || ||||||| |||| | ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18159144 |
taatagacattctgatctatcaaatttgaccttaaaaagctctacaagaaaaatatgagaactatctatcactatcatggtg |
18159063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 17 - 101
Target Start/End: Original strand, 18335026 - 18335110
Alignment:
| Q |
17 |
tgtaactgttgaattctttggtgacgatctcaatggagtcggttatagtgatcatgctgttgtgaaaaaatatgatctacgtgct |
101 |
Q |
| |
|
|||||| ||||| |||||||||| ||| |||||||||||| |||||||||||| |||| |||||||||||||| || ||||||| |
|
|
| T |
18335026 |
tgtaacagttgagttctttggtggcgaactcaatggagtcagttatagtgatcctgctactgtgaaaaaatatgctcgacgtgct |
18335110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University