View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5617_low_9 (Length: 269)
Name: NF5617_low_9
Description: NF5617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5617_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 3 - 150
Target Start/End: Original strand, 52860005 - 52860152
Alignment:
| Q |
3 |
aacataaaataagaaagagagagggaatcacatcacacattgaaatacaacaacaaatgactcttgttgtggggaacagcagcgtttgcagtgaccaaag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860005 |
aacataaaataagaaagagagagggaatcacatcacacattgaaatacagcaacagctgactcttgttgtggggaacagcagcgtttgcagtgaccaaag |
52860104 |
T |
 |
| Q |
103 |
tagcagagtagagcgcaaacgctcctgtgaactgaataactagctagt |
150 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860105 |
tagcagattagagcgcaaacgctcctgtgaactgaataactagctagt |
52860152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University