View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5618-Insertion-7 (Length: 175)
Name: NF5618-Insertion-7
Description: NF5618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5618-Insertion-7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 6e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 6e-79
Query Start/End: Original strand, 8 - 175
Target Start/End: Complemental strand, 23052407 - 23052239
Alignment:
| Q |
8 |
gaaactacatggtgaactaaatattaatttagtttaatcactttccttcgattc-attcttctctcttttcaattacaatgtcttacacaattttcagaa |
106 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23052407 |
gaaactgcatagtgaactaaatattaatttagtttaatcactttccttcgattccattcttctctcttttcaattacaatgtcttacacaattttcagaa |
23052308 |
T |
|
| Q |
107 |
ccttccaacttcacccttttctactctacccaacctcaatcctcaaactacaaaaccgttttttccatt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23052307 |
ccttccaacttcacccttttctactctatccaacctcaatcctcaaactacaaaaccgttttttccatt |
23052239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University