View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5618_high_5 (Length: 266)
Name: NF5618_high_5
Description: NF5618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5618_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 264
Target Start/End: Complemental strand, 26519024 - 26518779
Alignment:
| Q |
19 |
agttgatgggtgccacactagccactctgaccctcaaagtgttgtatcatgacaaggtggaaattggtgtagcattgacccaattttcaaacccaacttc |
118 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26519024 |
agttgatgggtgctacactggccactctgaccctcaaagtgttgtatcatgacaaggtggaaattggtgtagcattgacccaattttcaaacccaacttc |
26518925 |
T |
 |
| Q |
119 |
ttatcttgaagcattggtttgggaatccataatcactttcatattggtgctaactatttgtggtgttgccactgatcacagaggggtaacacaaccaaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26518924 |
ttatcttgaagcattggtttgggaatccataatcactttcatattggtgctaactatttgtggtgttgccactgatcacagaggggtaacacaaccaaaa |
26518825 |
T |
 |
| Q |
219 |
ctatacataatcacttcaattatttaatcctctttatgtacctttg |
264 |
Q |
| |
|
|||||| |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
26518824 |
ctatacttaattagttcaattatttaatcctctttatgtacctttg |
26518779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University