View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5618_high_8 (Length: 246)
Name: NF5618_high_8
Description: NF5618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5618_high_8 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 190 - 246
Target Start/End: Complemental strand, 9551946 - 9551890
Alignment:
| Q |
190 |
catactttataacatgaacacctctttgatgaattgaaatactaactatcccaacaa |
246 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9551946 |
catactttataacatgaacacttctttgatgaattgaaatactaactatcccaacaa |
9551890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 9552119 - 9552085
Alignment:
| Q |
17 |
atcacccttttcataatctttccatttggtagaag |
51 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
9552119 |
atcacccttttcatcatctttccatttggtagaag |
9552085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University