View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5618_low_6 (Length: 250)
Name: NF5618_low_6
Description: NF5618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5618_low_6 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 108 - 250
Target Start/End: Original strand, 35577618 - 35577760
Alignment:
| Q |
108 |
tatctattatgcgatacattttctattcatcaatgaatccataatcgacaacattatcaatgacaacattttcaaccgaattcctctcacacacattaaa |
207 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35577618 |
tatccattatgcgatacattttctgttcatcaatgaatccataatcgacaacattatcaatgacaacattttcaaccgaattcctctcacacacgttaaa |
35577717 |
T |
 |
| Q |
208 |
cttcagaatccacacttcacgccattcaaaacccaacacaatc |
250 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35577718 |
cttcagaatccacacttcaagccattcaaaacccaacacaatc |
35577760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 35563296 - 35563363
Alignment:
| Q |
19 |
ataaattaaaacaaggtctgaattcatttgtgttggattgaattcatgcccagctgcaccaactagtt |
86 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35563296 |
ataaaataaaacaaggtctgaattcatttgtgttggattgaattcatgcccagctgcattaactagtt |
35563363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University