View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5618_low_8 (Length: 246)

Name: NF5618_low_8
Description: NF5618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5618_low_8
NF5618_low_8
[»] chr6 (2 HSPs)
chr6 (190-246)||(9551890-9551946)
chr6 (17-51)||(9552085-9552119)


Alignment Details
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 190 - 246
Target Start/End: Complemental strand, 9551946 - 9551890
Alignment:
190 catactttataacatgaacacctctttgatgaattgaaatactaactatcccaacaa 246  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
9551946 catactttataacatgaacacttctttgatgaattgaaatactaactatcccaacaa 9551890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 9552119 - 9552085
Alignment:
17 atcacccttttcataatctttccatttggtagaag 51  Q
    |||||||||||||| ||||||||||||||||||||    
9552119 atcacccttttcatcatctttccatttggtagaag 9552085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University