View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5619_high_13 (Length: 236)
Name: NF5619_high_13
Description: NF5619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5619_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 6 - 104
Target Start/End: Original strand, 14323538 - 14323636
Alignment:
| Q |
6 |
aaatattatttttcatttaaatatatgtcaataatgacttaaaaacaatagtttttgaatttacaggggactcaccctaaacaaacagaacttgcaagg |
104 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14323538 |
aaatattatttttcttttaaatatatgtcaataatgacttcaaaacaatagtttttgaatttacaggggactcaccctaaacaaacagaacttgcaagg |
14323636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University