View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5619_low_9 (Length: 310)
Name: NF5619_low_9
Description: NF5619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5619_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 305
Target Start/End: Complemental strand, 38068327 - 38068035
Alignment:
| Q |
19 |
gtctgaacttgatcttagtcaaaacaagcttgaaggtactttattgccgtgttttccgtgcaaattgtagtcatattttgtatttctt------tactta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38068327 |
gtctgaacttgatcttagtcaaaacaagcttgaaggtactttattgccgtgttttccgtgcaaattgtagtcatattttgtatttcttgaacattactta |
38068228 |
T |
 |
| Q |
113 |
ttcatcaattttagtcaggatttaatttgtattcatcgacagtgcaaagcttttttacactgtcagttaatcataaaccattgaatcattaaattatttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38068227 |
ttcatcaattttagtcaggatttaatttgtattcatcgacagtgcaaagcttttttacactgtcagttaatcataaaccattcaatcattaaattatttt |
38068128 |
T |
 |
| Q |
213 |
acgatcatcatatctaacttaaaagtcttatacatgatcgtttatgattatttgattgtaaaaaattcaatgacagtgtatgcctatgcttct |
305 |
Q |
| |
|
|| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
38068127 |
actatcatcatatctaacttaatagtcttatacatgatcgtttatgattatttgattgtaaaaaattcaatgacagtgtatgcgtatgattct |
38068035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University