View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5623_low_5 (Length: 347)
Name: NF5623_low_5
Description: NF5623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5623_low_5 |
 | |
|
| [»] scaffold0219 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0219 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 218 - 338
Target Start/End: Original strand, 10725 - 10845
Alignment:
| Q |
218 |
ccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcagacaagtttatgatcaaggt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10725 |
ccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcagacaagtttatgatcaaggt |
10824 |
T |
|
| Q |
318 |
gtggaagcttgcaagaataat |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10825 |
gtggaagcttgcaagaataat |
10845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 216 - 323
Target Start/End: Original strand, 15697808 - 15697916
Alignment:
| Q |
216 |
gcccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcagacaag-tttatgatcaa |
314 |
Q |
| |
|
|||||||| |||||||||||||| | | |||||| |||||| |||| ||||||||||||||| ||||||||||| ||||||| ||||| |||| ||| | |
|
|
| T |
15697808 |
gcccttgtaaattttgatgatctatctctcatgctattactgaaactttgcatcaaaggggactcagtttgcattaaactcacacaagacttataatcga |
15697907 |
T |
|
| Q |
315 |
ggtgtggaa |
323 |
Q |
| |
|
||||||||| |
|
|
| T |
15697908 |
ggtgtggaa |
15697916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 199 - 334
Target Start/End: Original strand, 18711195 - 18711333
Alignment:
| Q |
199 |
cttgttctttcgcacaagcccttgttaattttgatgatctctttttcatgcaattacttaaaccttgcatcaaaggggattcagtttgcatcaaactcag |
298 |
Q |
| |
|
||||||| ||||||||||| || |||||| | |||||||| |||| |||||| ||||| |||||||||||||||||| ||||||| ||||||| |
|
|
| T |
18711195 |
cttgttccttcgcacaagctctatttaattctaatgatctcgccttcactcaattatcgaaaccctgcatcaaaggggattcaatttgcattaaactcat |
18711294 |
T |
|
| Q |
299 |
ac---aagtttatgatcaaggtgtggaagcttgcaagaa |
334 |
Q |
| |
|
|| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
18711295 |
acaagaagtttatgatcgcggtgtggaaggttgcaagaa |
18711333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University