View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5623_low_9 (Length: 261)
Name: NF5623_low_9
Description: NF5623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5623_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 47179254 - 47179037
Alignment:
| Q |
17 |
taaaacaactaaacctcatttaacttgaattgatttttgttagaaccaagttggaatttaaagaacaatgatctccaattttggttctgttgataccaaa |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47179254 |
taaaacaactgaacctcatttaacttgaattgatttttgttagaaccaagttggaatttaaagaacaatgatctccaattttggttctgttgaaaccaaa |
47179155 |
T |
|
| Q |
117 |
gtatataagagaacaattttttctctaacttgtgtttgaatgtgtagaaagtatttttagtattgaaaccatgaaaatcggatacggctgtcataaaaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47179154 |
gtatataagagaacaattttttctcta------------------agaaagtatttttagtattgaaaccatgaaaatcggatacggctgtcataaaaat |
47179073 |
T |
|
| Q |
217 |
ctgaagtcactgcagtcacctaatatctaccctatg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47179072 |
ctgaagtcactgcagtcacctaatatctaccctatg |
47179037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University