View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5624-Insertion-5 (Length: 311)
Name: NF5624-Insertion-5
Description: NF5624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5624-Insertion-5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 109 - 163
Target Start/End: Complemental strand, 2361907 - 2361853
Alignment:
| Q |
109 |
aattctaactacttgtttttgtcttttctcactccattactactattaatacgtg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2361907 |
aattctaactacttgtttttgtcttttctcactccattactactattaatacgtg |
2361853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 42
Target Start/End: Complemental strand, 2362002 - 2361974
Alignment:
| Q |
14 |
ccccacccaacccaacttgcttgtgcctc |
42 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2362002 |
ccccacccaacccaacttgcttgtgcctc |
2361974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University