View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5624-Insertion-5 (Length: 311)

Name: NF5624-Insertion-5
Description: NF5624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5624-Insertion-5
NF5624-Insertion-5
[»] chr5 (2 HSPs)
chr5 (109-163)||(2361853-2361907)
chr5 (14-42)||(2361974-2362002)


Alignment Details
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 109 - 163
Target Start/End: Complemental strand, 2361907 - 2361853
Alignment:
109 aattctaactacttgtttttgtcttttctcactccattactactattaatacgtg 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2361907 aattctaactacttgtttttgtcttttctcactccattactactattaatacgtg 2361853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 42
Target Start/End: Complemental strand, 2362002 - 2361974
Alignment:
14 ccccacccaacccaacttgcttgtgcctc 42  Q
    |||||||||||||||||||||||||||||    
2362002 ccccacccaacccaacttgcttgtgcctc 2361974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University