View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5625_high_19 (Length: 293)
Name: NF5625_high_19
Description: NF5625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5625_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 15 - 281
Target Start/End: Original strand, 6443617 - 6443884
Alignment:
| Q |
15 |
ggatgaacgttcaagttatcatcagatgcaaa-ttattatcagatacaaatggtacaaggagacatacataaaacaacattttgtattcaccaaggtcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6443617 |
ggatgaacgttcaagttatcatcagatgcaaaattattatcagatacaaatggtacagggagacatacataaaacaacattttgtattgaccaaggtcat |
6443716 |
T |
|
| Q |
114 |
tatatgaatatcatgtttcgaccatatttgcttcactttgttatcttannnnnnngatgatattttggttgatagtccccatacgaccaccttcactact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6443717 |
tatatgaatatcatgtttcgaccatatttgcttcactttgttatcttatttttttgatgatattttggttgatagtccccatacgaccaccttcactact |
6443816 |
T |
|
| Q |
214 |
tacttgaaaatagtttttaagtgtttgatggaaaatcaattttcccctaagcaaatctaaagtatcct |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6443817 |
tacttgaaaatagtttttaagtgtttgatggaaaatcaattttcccctaagcaaatctaaagtatcct |
6443884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University