View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5625_high_21 (Length: 282)
Name: NF5625_high_21
Description: NF5625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5625_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 43 - 266
Target Start/End: Original strand, 32420544 - 32420767
Alignment:
| Q |
43 |
ttctcttaatttcttcttttttgaggaattgttatttgctaagttgtgagggggaatatttatagatagttgaagttgaaaattgtgacttattggtact |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32420544 |
ttctcttaatttcttcttttttgaggaattgttatttgctaagttgtgagggggaatatttatagatagttgaagttgaaaattgtgacttattggtact |
32420643 |
T |
 |
| Q |
143 |
tgaattggcccctaggtttagcggggttagtgtctttaatcgaagtttggaaattggaacacgggaaaatttaaactagaggcctacttactctggtttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32420644 |
tgaattggcccctaggtttagcggggttagtgtctttaatcgaagtttggaaattggaacacgggaaaatttaaactagaggcctacttactctggtttt |
32420743 |
T |
 |
| Q |
243 |
tgttctctacgtgagtgtgtgtct |
266 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32420744 |
tgttctctacgtgagtgtgtgtct |
32420767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University