View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5625_high_31 (Length: 201)
Name: NF5625_high_31
Description: NF5625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5625_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 21 - 178
Target Start/End: Original strand, 51930091 - 51930254
Alignment:
| Q |
21 |
gagccaatagtagttatcgatcctcacatcatggaaaagctccattttgtgctcaaccttcttcgccaccggaggaggaagcggagattgagactgcggc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51930091 |
gagccaatagtagttatcgatcctcacatcattgaaaagctccattttgtgctcaaccttcttcgccaccggaggaggaagcggagattgagaatgcggc |
51930190 |
T |
 |
| Q |
121 |
gaca------gagattgtggaggtgaagtcgtcatcggacggcggtggtgatgagagaacgcgg |
178 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51930191 |
gacagagattgagattgtggaggtgaagtcgtcatcggacggcggtggtgatgagagaacgcgg |
51930254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University