View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5625_low_12 (Length: 356)
Name: NF5625_low_12
Description: NF5625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5625_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 10 - 339
Target Start/End: Original strand, 1110607 - 1110936
Alignment:
| Q |
10 |
attattctcttcataaacattttgaggtctagattctacaaagggttctaaagctttcaattttcccttaggactttgacttggaaaagtatcttgggta |
109 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1110607 |
attattttcctcataaacattttgaggtctagattctacaaagggttctaaagccttcaattttcccttaggactttgacttggaaaagtatcttgggta |
1110706 |
T |
|
| Q |
110 |
cctttttgttccttcaatttgttcaagtcatttaaccctgtcacaatattacttggagatgaaggaaccttcttgtctctaattataggttcttctagta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1110707 |
cctttttgttccttcaatttgttcaagtcatttaaccctgtcacaatattacttggagatgaaggaaccttcttgtctctaactataggttcttctagta |
1110806 |
T |
|
| Q |
210 |
ctctagttggaggctttgaaggaatattggttcccttaggtgttctaggacttggcacaattttttctttggttgtttcaacttgtgattttagtgatgg |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1110807 |
ctctagttggaggctttgaaggaatattggttcccttaggtgttctaggacttggcacaattttttctttggttgtttcaacttgtgatttcagtgatgg |
1110906 |
T |
|
| Q |
310 |
gtacttttttggcatggcaacaatgagagt |
339 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
1110907 |
gtacttttttggcattgcaacaatgagagt |
1110936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University