View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5625_low_28 (Length: 241)
Name: NF5625_low_28
Description: NF5625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5625_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 22 - 226
Target Start/End: Original strand, 14267287 - 14267489
Alignment:
| Q |
22 |
atcgtgaatgttaagaatatattattacacatgtgaaaattaaaagagagatcgaaaggcatcacaacttttccatgtaacaagttatacataaatttat |
121 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14267287 |
atcgtaaatgttaagaatatattattacacatgtgaaaattaaaagagagatcgaaaggcatcacaacttttccatgtaacaagttatgcataaatttat |
14267386 |
T |
 |
| Q |
122 |
actataaacccaaaatgaggaggatgactccctatgatcctgtatgtatgtgtaagtatggcaacggtgtgaagacaagtttttcctctcttatcctcac |
221 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14267387 |
actataaacccaaaatgaggtgaatgactctctatgatcctgtatgta--tgtaagtatggcaacggtgtgaagacaagtttttcctctcttatcctcac |
14267484 |
T |
 |
| Q |
222 |
ctttg |
226 |
Q |
| |
|
||||| |
|
|
| T |
14267485 |
ctttg |
14267489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University