View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5625_low_30 (Length: 216)

Name: NF5625_low_30
Description: NF5625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5625_low_30
NF5625_low_30
[»] chr3 (1 HSPs)
chr3 (11-199)||(30553119-30553314)


Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 30553314 - 30553119
Alignment:
11 gaattgttaacgttcatccttgaagacgatgcctgaaacctnnnnnnnnnnnnttgattattcgaagtttgttttcttgatttttctaatctttaatcct 110  Q
    |||| |||||||||||||||| |||||||||||||||||||            | |||||||| ||||||||||||||| ||||||||||||||||||||    
30553314 gaatcgttaacgttcatccttaaagacgatgcctgaaacctaaaaaataaaaatcgattattccaagtttgttttcttggtttttctaatctttaatcct 30553215  T
111 gaaatcaatttcactcatcataatatcggtttcttaactcagaaacctcttaaaacat-------tgcagaatcacacaaaaataaattaacatca 199  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||| |||||||||    
30553214 gaaattaatttcactcatcctaatatcggtttcttaactcagaaacctcttaaaacattgcacattgcagaatcacacaaaaataatttaacatca 30553119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University