View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5625_low_30 (Length: 216)
Name: NF5625_low_30
Description: NF5625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5625_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 30553314 - 30553119
Alignment:
| Q |
11 |
gaattgttaacgttcatccttgaagacgatgcctgaaacctnnnnnnnnnnnnttgattattcgaagtttgttttcttgatttttctaatctttaatcct |
110 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||| | |||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30553314 |
gaatcgttaacgttcatccttaaagacgatgcctgaaacctaaaaaataaaaatcgattattccaagtttgttttcttggtttttctaatctttaatcct |
30553215 |
T |
 |
| Q |
111 |
gaaatcaatttcactcatcataatatcggtttcttaactcagaaacctcttaaaacat-------tgcagaatcacacaaaaataaattaacatca |
199 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
30553214 |
gaaattaatttcactcatcctaatatcggtttcttaactcagaaacctcttaaaacattgcacattgcagaatcacacaaaaataatttaacatca |
30553119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University