View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5625_low_31 (Length: 201)
Name: NF5625_low_31
Description: NF5625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5625_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 37582629 - 37582798
Alignment:
| Q |
19 |
ctggctatggcggcccaattttgcaattatgccctctatat----cacgctagtctcaactttcatggcggagaattattaaatgtacccccgcaaaaag |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37582629 |
ctggctataacggcccaattttgcaattaggccctctatatgcatcacgctagtctcaactttcatggcggagaattattatatgtacccccgcaaaaat |
37582728 |
T |
|
| Q |
115 |
atattgaccctgcattttccactttcgataaaaaacaatatccttctttaattttttagccaaacacccta |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37582729 |
atattgaccctgcattttccactttcgat-aaaaacaatatccttctttaattttttagccaaacacccta |
37582798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University