View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5626_high_12 (Length: 241)
Name: NF5626_high_12
Description: NF5626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5626_high_12 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 46255492 - 46255267
Alignment:
| Q |
16 |
catgcgtgtctgagtttcattatgtactctgcacaattatcagttgtaggaaccctttcaacttgtctgacttgctctttcatctactattgtcagtttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
46255492 |
catgcgtgtctgagtttcattatgtactctgcacaattatcagttgtaggaaccctttcaacttgtctgacttgctctttcatctactgttatcagtttt |
46255393 |
T |
|
| Q |
116 |
gcatataaaatcttgaggaggtttttgcctgaagagaaggttgaggctttgaaaggtcttactatcactgcagatggaaatggtgttgtttttgatgtag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46255392 |
gcatataaaatcttgaggaggtttttgcctgaatagaaggttgaggctgtgaaaggtcttactatcactgcagatggaaatggtgttgtttttgatgtag |
46255293 |
T |
|
| Q |
216 |
catccgaagatttagatacatatctt |
241 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
46255292 |
cagccgaagatttagatacatatctt |
46255267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 46245803 - 46245578
Alignment:
| Q |
16 |
catgcgtgtctgagtttcattatgtactctgcacaattatcagttgtaggaaccctttcaacttgtctgacttgctctttcatctactattgtcagtttt |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46245803 |
catgcgtgtctgtgtttcattatgtactctgcacaattattagttgtaggaaccctttcaacttgtctgacttgctctttcatctactgttgtcagtttt |
46245704 |
T |
|
| Q |
116 |
gcatataaaatcttgaggaggtttttgcctgaagagaaggttgaggctttgaaaggtcttactatcactgcagatggaaatggtgttgtttttgatgtag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46245703 |
gcatataaaatcttgaggaggtttttgcctgaagagaaggttgaggctgtgaaaggtcttactatcactgcagatggaaatggtgttgtttttgatgtag |
46245604 |
T |
|
| Q |
216 |
catccgaagatttagatacatatctt |
241 |
Q |
| |
|
|| | ||||||||||||||||||||| |
|
|
| T |
46245603 |
cagctgaagatttagatacatatctt |
46245578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University