View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5626_high_16 (Length: 232)
Name: NF5626_high_16
Description: NF5626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5626_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 212
Target Start/End: Original strand, 6001347 - 6001544
Alignment:
| Q |
15 |
aatatccaatgagataaaactttgatgaaccaaaacagagtgcaacataacaaaaagcaaacaaaattggaaaatatcttaatgaaacataaaacaagaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6001347 |
aatatccaatgagataaaactttgatgaaccaaaacagagtgcaacataacaaaaagcaaacaaaattggaaaatatcttaatgaaacataaaacaagaa |
6001446 |
T |
|
| Q |
115 |
atattttgatggttaagaaagtaatcagtcttattacactgaggtaggtatccaactgttggaatctgtgtcagggtcagtcatgtgtaagtgggtaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
6001447 |
atattttgatggttaagaaagtaatcagtcttactacactgaggtaggtatccaactgttggaacctgtgtcagggtcagtcatgtgcaagtgggtaa |
6001544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University