View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5626_low_10 (Length: 368)
Name: NF5626_low_10
Description: NF5626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5626_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 67 - 352
Target Start/End: Original strand, 34869588 - 34869873
Alignment:
| Q |
67 |
agggaatatctggcattactatttgctatataatttgtggcgttattttgtatgaatataatttgcaaaacaagcctgtgtaatactgcactttaattgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869588 |
agggaatatctggcattactatttgctatataatttgtggcgttattttgtatgaatataatttgcaaaacaagcctgtgtaatactgcactttaattgt |
34869687 |
T |
|
| Q |
167 |
gtcggtggagatatatctttttggttattgtttaaatataaaactgtggttatttaagatgataatgtaacttttgcagaattacannnnnnnnaaaaga |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34869688 |
gtcggtggagatatatctttttggttattgtttaaatataaaactgtggttctttaagatgataatgtaacttttgcagaattaatttttttttaaaaga |
34869787 |
T |
|
| Q |
267 |
ggatcatcttgtaatattgtgacaaaatagaaattagaatcttaagactgttgatatttttgtcgggtacaattttggtcctgcaa |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869788 |
ggatcatcttgtaatattgtgacaaaatagaaattagaatcttaagagtgttgatatttttgtcgggtacaattttggtcctgcaa |
34869873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University