View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5627-Insertion-6 (Length: 554)
Name: NF5627-Insertion-6
Description: NF5627
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5627-Insertion-6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 539; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 539; E-Value: 0
Query Start/End: Original strand, 8 - 554
Target Start/End: Original strand, 13212397 - 13212943
Alignment:
| Q |
8 |
cctaaccctccatttcctggcacattcactggtgtttcttcatcttctaaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212397 |
cctaaccctccatttcctggcacattcactggtgtttcttcatcttctaaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaa |
13212496 |
T |
|
| Q |
108 |
ccggaccggaagctaacaacggtcccaccacgctaccaccgacgacctgtccttgtccaccagctagatatatggctaatcctgacgccgctggtggagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212497 |
ccggaccggaagctaacaacggtcccaccacgctaccaccgacgacctgtccttgtccaccagctagatatatggctaatcctgacgccgctggtggagc |
13212596 |
T |
|
| Q |
208 |
aggcggcggcaggaaagagccagataatgataatatctcaaatcttccatgaagtgtgactaccgcaccaggcgatgctggttgacggagagtcacgttt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212597 |
aggcggcggcaggaaagagccagataatgataatatctcaaatcttccatgaagtgtgactaccgcaccaggcgatgctggttgacggagagtcacgttt |
13212696 |
T |
|
| Q |
308 |
gtgacggtcccacttccgctaaggatgcagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttcca |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212697 |
gtgacggtcccacttccgctaaggatgcagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttcca |
13212796 |
T |
|
| Q |
408 |
tcacgtgggatcggagtgcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttcttcc |
507 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212797 |
tcacgtgggatcggagtgcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttcttcc |
13212896 |
T |
|
| Q |
508 |
catctcaccaccacttcctccatcagcacttccgctaccgccgtcgt |
554 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
13212897 |
catctcaccaccacttcctccaccagcacttccgctaccaccgtcgt |
13212943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 425 - 505
Target Start/End: Original strand, 3332356 - 3332436
Alignment:
| Q |
425 |
gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttctt |
505 |
Q |
| |
|
||||| |||||||| | |||||||| || |||||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
3332356 |
gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttctt |
3332436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 455 - 503
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
| Q |
455 |
ggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc |
503 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
16578665 |
ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc |
16578617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 451 - 503
Target Start/End: Original strand, 32803226 - 32803278
Alignment:
| Q |
451 |
gataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc |
503 |
Q |
| |
|
|||||||||||||||| ||||||| || || | |||||||||||||||||||| |
|
|
| T |
32803226 |
gataggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc |
32803278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 437 - 474
Target Start/End: Complemental strand, 46200969 - 46200932
Alignment:
| Q |
437 |
tccctcgtgatgatgataggtggttttggtttgttttt |
474 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
46200969 |
tcccttgtgatgataataggtggttttggtttgttttt |
46200932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University