View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5628-Insertion-1 (Length: 131)
Name: NF5628-Insertion-1
Description: NF5628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5628-Insertion-1 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 5630736 - 5630613
Alignment:
| Q |
8 |
aaaactcttatttttcttcaaaggacattgttgttcgtgtctctcaaattctgtagagacatggaaacaatggaacaaaggcttgtctcaagttggtcta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5630736 |
aaaactcttatttttcttcaaaggacattgttgtttgtgtctctcaaattctgtagagacatggaaacaatggaacaaaggcttgtctcaagttggtcta |
5630637 |
T |
|
| Q |
108 |
atgttcattcctcagttccacctt |
131 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5630636 |
atgttcattcctcagttccacctt |
5630613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 6e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 6e-32
Query Start/End: Original strand, 13 - 131
Target Start/End: Original strand, 16433013 - 16433143
Alignment:
| Q |
13 |
tcttatttttcttcaaaggacattgttgttcgtgtctctcaaattctgtagagaca------------tggaaacaatggaacaaaggcttgtctcaagt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
16433013 |
tcttatttttcttcaaatgacattgttgtttgtgtctctcaaattctatagagacaacataggaaacatggaaacaatggaacaaaggcttatctcaagt |
16433112 |
T |
|
| Q |
101 |
tggtctaatgttcattcctcagttccacctt |
131 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |
|
|
| T |
16433113 |
tggtctaatgttaattcctcagttccacctt |
16433143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University