View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5628-Insertion-13 (Length: 275)
Name: NF5628-Insertion-13
Description: NF5628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5628-Insertion-13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 48 - 207
Target Start/End: Original strand, 2623093 - 2623252
Alignment:
| Q |
48 |
aataggggaccaacaacatgctacctcatgtgaaattttaccgtgtctaatttttgcgcacttcattatatacttagattcctctataaattctgatgtt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2623093 |
aataggggaccaacaacatgctacctcatgtgaaattttaccgtgtctaatttttgcgcacttcattatatacttagattcctctataaattctgatgtt |
2623192 |
T |
 |
| Q |
148 |
aagaacacagtcgctgcaatagtccttgtgcttggcatttctagaagaaccttaaccctt |
207 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2623193 |
aagaacacagtcgctgaagtagtccttgtgcttggcatttctagaagaaccttaaccctt |
2623252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University