View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5628-Insertion-17 (Length: 227)
Name: NF5628-Insertion-17
Description: NF5628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5628-Insertion-17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 27 - 192
Target Start/End: Original strand, 6495335 - 6495500
Alignment:
| Q |
27 |
tcaagcagactccactgacatgatttcattattgtaccaaaatatattttagtatacagcaatatcttaccgaaagtttaggttggcagattataataaa |
126 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6495335 |
tcaagcagattccactgacatgatttcattatggtaccaaaatatattttagtatacagcaatatcttaccgaaagttaaggttggcagattataataaa |
6495434 |
T |
|
| Q |
127 |
tagtgatgcattacaaaataacaaatgaaataatgctaaaagttttcgttaaaagatattccaact |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
6495435 |
cagtgatgcattacaaaataacaaatgaaataatactaaaagtttttgttaaaagatattccaact |
6495500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University