View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5628_low_11 (Length: 251)
Name: NF5628_low_11
Description: NF5628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5628_low_11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 34390860 - 34390623
Alignment:
| Q |
13 |
aaaatagaataagatttattaattgtttaattttgtttgtatgtatgtaagggtgcaagtgtgctggcttttttgtgtatttgaagttcata-taccata |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
34390860 |
aaaatagaataagatttattaattgtttaattttgtttgtatgtatgtaagggtgcaagtgtgcttgcttttttgtgtatttgaagttcatattaccata |
34390761 |
T |
|
| Q |
112 |
tagatagattatttctgtttctttaannnnnnnccgggtttcttataatatacaattgtttgattcattataccctcnnnnnnnntttgtttgattcatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34390760 |
tagatagattatttctgtttctttaa-ttttttccgggtttcttataatatacaattgtttgattcattataccctc-aaaaaaatttgtttgattcatt |
34390663 |
T |
|
| Q |
212 |
atgaaactctaattaatttcaccaattcagtaagaatata |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34390662 |
atgaaactctaattaatttcaccaattcagttagaatata |
34390623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University