View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5628_low_14 (Length: 215)
Name: NF5628_low_14
Description: NF5628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5628_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 34390243 - 34390403
Alignment:
| Q |
1 |
ctttcgtgagcatcacaacttcattttcttttagtttcctttgtgttgagggaaat-cttttcataaatattgatgaaaggaagggtgatttgaatattt |
99 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34390243 |
ctttcgtgagcatcacaacttcatttccttttagtttcctttgtgttgagggaagttcttttcataaatattgatgaaaggaagggtgatttgaatattt |
34390342 |
T |
 |
| Q |
100 |
catctgagtttcaagatttcatcttgttatcgatccttcttttgattaatgtgaccaaacc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34390343 |
catctgagtttcaagatttcatcttgttatcgatccttcttttgattaatgtgaccaaacc |
34390403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University