View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_high_25 (Length: 361)
Name: NF5629_high_25
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_high_25 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 18 - 361
Target Start/End: Complemental strand, 38598786 - 38598443
Alignment:
| Q |
18 |
agcactgtcattaaagcctcttgtcattgttggcaggggcataaatgggcttcttgcggtgcttaatgatccacattagagagttgctgtcattgttcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38598786 |
agcactgtcattaaagcctcttgtcattgttggcaggggcataaatgggcttcttgcggtgcttaatgatccacattagagagttgctgtcattgttcag |
38598687 |
T |
|
| Q |
118 |
caaaggaatcatactatctgcacttgaacaccattgcctccaactcagagtatcatttatcaatgagtagaagaacaaagggaaggttgaattgtagtaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38598686 |
caaaggaatcatactatctgcacttgaacgccattgcctccaactcagagtatcatttatcaatgagtagaagaacaaagggaaggttgaattgtagtaa |
38598587 |
T |
|
| Q |
218 |
atctgagttgaggactagcagagacagtgctttacggagtgagcaagtctattgagaaactggccggagaaagtaactcacactctcatgcatcgatgag |
317 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38598586 |
atctgagttgaggactagcagagacggtgctttacggagtgagcaagtctattgagaaactggccggagaaagtaactcacactctcatgcatcgatgag |
38598487 |
T |
|
| Q |
318 |
tcatttatagccagatttcagcaacccgcatgtgaagaaaaatc |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38598486 |
tcatttatagccagatttcagcaacccgcatgtgaagaaaaatc |
38598443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University