View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_high_40 (Length: 282)
Name: NF5629_high_40
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 264
Target Start/End: Original strand, 5288220 - 5288464
Alignment:
| Q |
19 |
aattaggccacacttttactagttgtatttgaatgcaatccaacgtgacttaatctacgttggagtttgtcgtacgttaactcatgttgatatctaacct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
5288220 |
aattaggccacacttttactagttgtatttgaatgcaacccaacgtgacttaatttacgttggagtttgtcgtacgttaactcatattgatatctaacgt |
5288319 |
T |
 |
| Q |
119 |
aaatgtaagttaacttacattagttttatcaatcataatttaacttaggttgaggttattttatgctctttgggggtgggaaggagtaaaaatgattggg |
218 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
5288320 |
aaacgtaagttaacttgcattagttttatcaatcataatttaacttaggttgaggttattttatgct-ttttggggtgggaaggagtaaaaatgattggg |
5288418 |
T |
 |
| Q |
219 |
agaacgaatcgctaaggtggccaattggttacgataggcagcatag |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5288419 |
agaacgaatcgctaaggtggccaattggttacgataggcagcatag |
5288464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University