View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_high_58 (Length: 239)
Name: NF5629_high_58
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_high_58 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 42747404 - 42747198
Alignment:
| Q |
15 |
tttctgttcaattctagatatcttcagtgttacgcattcaaagtacactgccgatctcttagttaataagttgcttttctttctttattgcatgtgatta |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
42747404 |
tttctgtcaaattctagatatcttcagtgttacgcattcaaagtacactgccgatctcttagttaataagttgcttttctttctttgttgcatatgatta |
42747305 |
T |
 |
| Q |
115 |
tatgatttttagagtgagagtaagaattgttacaaagtgattaaagggtcttggaaagaaatagatgacacagccaatacaccaggaggaatagaacagc |
214 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42747304 |
tatgatttttagagtgagagtgagaattgttacaaagtgattaaagggtcttggaaagaaatagatgacacagccaatacaccaggaggaatagaacagc |
42747205 |
T |
 |
| Q |
215 |
tacagaa |
221 |
Q |
| |
|
||||||| |
|
|
| T |
42747204 |
tacagaa |
42747198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 170
Target Start/End: Complemental strand, 42742578 - 42742533
Alignment:
| Q |
125 |
agagtgagagtaagaattgttacaaagtgattaaagggtcttggaa |
170 |
Q |
| |
|
||||||||||| | ||||||||||||||||| |||||||| ||||| |
|
|
| T |
42742578 |
agagtgagagtgaaaattgttacaaagtgataaaagggtcatggaa |
42742533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University