View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_high_61 (Length: 236)
Name: NF5629_high_61
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_high_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 14 - 145
Target Start/End: Complemental strand, 28937436 - 28937305
Alignment:
| Q |
14 |
attgaaacgtgtattagcatcaccaacgaaaataaataaataaagctatgtagaactagaatttaccccatcacatacctctaaatttcactattcatat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28937436 |
attgaaacgtgtattagcatcaccaacgaaaataaataaataaagctatgtagaactagaatttgccccatcacatacctctaaatttcactattcatat |
28937337 |
T |
|
| Q |
114 |
gatcaaataaaagtattgaaaaatactatatg |
145 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
28937336 |
gatcaaataaaagtattgaaaaatattatatg |
28937305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 199 - 236
Target Start/End: Complemental strand, 28937249 - 28937212
Alignment:
| Q |
199 |
gccatagtaaataactattgttaatgtctcgttagctt |
236 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28937249 |
gccatagtaaataactattgttaaggtctcgttagctt |
28937212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University