View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_low_19 (Length: 381)
Name: NF5629_low_19
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 155 - 307
Target Start/End: Original strand, 37164527 - 37164675
Alignment:
| Q |
155 |
agctacatataagggttcgaagcccagtaaatttaaaaaacatgtaaaacaattaaagatgatatgtattcagaagtcaattagagataatatgtatttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37164527 |
agctacatataagggttcgaagcccagtaaatttaaaaaacatgtaaaacaactaaagatgatatgtattcagaagtcaattagagataatatgtatttt |
37164626 |
T |
|
| Q |
255 |
gaagtgaggtcgtgataacttaaatagctagattctgcataaacacaggttat |
307 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
37164627 |
gaagtgaggtcgtgata----aaatagctagattctgcataaacacgggttat |
37164675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 304 - 336
Target Start/End: Original strand, 37164707 - 37164739
Alignment:
| Q |
304 |
ttatatgtatttgaaaagattaacacatgctta |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37164707 |
ttatatgtatttgaaaagattaacacatgctta |
37164739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University