View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_low_23 (Length: 367)
Name: NF5629_low_23
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 45540239 - 45540468
Alignment:
| Q |
19 |
aatattgatttacgaactggtcatgctacaaatgcttatcaaccaccacctccgttaacagaacaagagcttgggagagcatctaacaatcctttggaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540239 |
aatattgatttacgaactggtcatgccacaaatgcttatcaaccaccacctccgttaacagaacaagagcttgggagagcatctaacaatcctttggaag |
45540338 |
T |
 |
| Q |
119 |
ctcattctcatataccagacatcaaccaagcctccgtgacatcattgtcgtcatcgttccaaaatccattcctaggaccaagtgaggcaaccaacgacac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45540339 |
ctcattctcatataccagacatcaaccaagcccccgtgacatcattgtcgtcatcgttccaaaatccattcataggaccaagtgaggcaaccaacgacac |
45540438 |
T |
 |
| Q |
219 |
tgttgaggatgacacaaacattggtagttc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45540439 |
tgttgaggatgacacaaacattggtagttc |
45540468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 246 - 359
Target Start/End: Original strand, 45540505 - 45540618
Alignment:
| Q |
246 |
ttcttcaactaatgttatttcaaatctcaattcaccaacatccacatatgaattgtcgcaagagagttcattcaatgagaaaacaaatacaaataacagt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540505 |
ttcttcaactaatgttatttcaaatctcaattcaccaacatccacatatgaattgtcgcaagaaagttcattcaatgagaaaacaaatacaaataacagt |
45540604 |
T |
 |
| Q |
346 |
gactctgatgatgt |
359 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
45540605 |
gactccgatgatgt |
45540618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University