View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5629_low_41 (Length: 280)
Name: NF5629_low_41
Description: NF5629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5629_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 81 - 263
Target Start/End: Original strand, 37544534 - 37544716
Alignment:
| Q |
81 |
ggagaagatattaaattaaataaaacaacggaactctaaaataagtgtgatcaacgcttattaaacaataatttaagcaatcacaaccctctccataatc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37544534 |
ggagaagatattaaattaaataaaacaacggaactctaaaataagtgtgatcaacgcttattaaacaataatttaagcaatcacaaccctctccataatc |
37544633 |
T |
 |
| Q |
181 |
aatcataacctttgaacaatatggtgtttatataacactaatttaagcagtaatttcatggtctagcgataacactatcttat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37544634 |
aatcataacctttgaacaatatggtgtttatataacactaatttaagcagtaatttcatggtctagcgataacactatcttat |
37544716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University